Incidental Mutation 'R0557:Wnt5b'
ID45624
Institutional Source Beutler Lab
Gene Symbol Wnt5b
Ensembl Gene ENSMUSG00000030170
Gene Namewingless-type MMTV integration site family, member 5B
SynonymsWnt-5b
MMRRC Submission 038749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0557 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location119432531-119544347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119433818 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 220 (H220Q)
Ref Sequence ENSEMBL: ENSMUSP00000137065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117171] [ENSMUST00000118120] [ENSMUST00000119369] [ENSMUST00000178696]
Predicted Effect probably damaging
Transcript: ENSMUST00000117171
AA Change: H220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113188
Gene: ENSMUSG00000030170
AA Change: H220Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118120
AA Change: H182Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112819
Gene: ENSMUSG00000030170
AA Change: H182Q

DomainStartEndE-ValueType
WNT1 12 321 3.47e-215 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119369
AA Change: H233Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170
AA Change: H233Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
WNT1 63 372 3.47e-215 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178696
AA Change: H220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170
AA Change: H220Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal numbers of thoracic motor neurons and proportions of motor columnar subtypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Ano3 A T 2: 110,862,952 probably null Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chchd6 A G 6: 89,574,587 S31P probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mki67 C T 7: 135,699,261 S1348N possibly damaging Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Olfr350 T A 2: 36,850,748 I234N possibly damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Ppm1l A G 3: 69,497,901 D177G probably benign Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Wnt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Wnt5b APN 6 119440554 missense possibly damaging 0.70
IGL01822:Wnt5b APN 6 119433472 missense probably damaging 1.00
luftmensch UTSW 6 119433852 missense probably damaging 0.97
R0732:Wnt5b UTSW 6 119446582 nonsense probably null
R1472:Wnt5b UTSW 6 119433481 missense probably damaging 1.00
R1673:Wnt5b UTSW 6 119446354 missense probably benign 0.19
R4202:Wnt5b UTSW 6 119440311 missense probably damaging 1.00
R5100:Wnt5b UTSW 6 119440488 missense probably benign 0.20
R5264:Wnt5b UTSW 6 119433852 missense probably damaging 0.97
R5393:Wnt5b UTSW 6 119440433 missense probably damaging 1.00
R5394:Wnt5b UTSW 6 119440322 missense probably damaging 0.98
R5482:Wnt5b UTSW 6 119446431 missense probably benign 0.19
R5741:Wnt5b UTSW 6 119433729 missense probably damaging 1.00
R5902:Wnt5b UTSW 6 119448238 missense probably benign 0.00
R6005:Wnt5b UTSW 6 119433654 missense probably benign 0.04
R6061:Wnt5b UTSW 6 119433642 missense probably damaging 0.98
R6208:Wnt5b UTSW 6 119446512 missense probably damaging 1.00
R6405:Wnt5b UTSW 6 119433496 missense probably benign 0.06
R6478:Wnt5b UTSW 6 119433790 missense probably damaging 1.00
R6482:Wnt5b UTSW 6 119433612 missense possibly damaging 0.88
R7047:Wnt5b UTSW 6 119448256 start gained probably benign
R7338:Wnt5b UTSW 6 119448131 splice site probably null
R8044:Wnt5b UTSW 6 119446358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGGACTGGGGTCCACGTA -3'
(R):5'- GAGCACCCACTGTCTCTGTCTCTAT -3'

Sequencing Primer
(F):5'- TCCACGTAGACCAGGTCCTC -3'
(R):5'- gttttgtttgtttgtttgtttgtttg -3'
Posted On2013-06-11