Incidental Mutation 'R5889:Dsg1c'
ID456248
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20283601 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 853 (I853R)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054128
AA Change: I853R

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: I853R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGAATGCCTACCCCTCTG -3'
(R):5'- GGCACTTGATAACTCAGGGG -3'

Sequencing Primer
(F):5'- CCTGGAGTACAGCATCCTATG -3'
(R):5'- GGGGATGCTCAGGTTGCCTATC -3'
Posted On2017-02-15