Incidental Mutation 'R5889:Pcdhga3'
ID456249
Institutional Source Beutler Lab
Gene Symbol Pcdhga3
Ensembl Gene ENSMUSG00000104346
Gene Nameprotocadherin gamma subfamily A, 3
Synonyms
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37674307-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37676609 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 705 (V705D)
Ref Sequence ENSEMBL: ENSMUSP00000073150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000073447
AA Change: V705D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346
AA Change: V705D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195624
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Pcdhga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Pcdhga3 APN 18 37675433 missense possibly damaging 0.92
R2863:Pcdhga3 UTSW 18 37674590 missense probably damaging 0.99
R4446:Pcdhga3 UTSW 18 37675885 missense probably damaging 0.99
R4581:Pcdhga3 UTSW 18 37676881 missense probably benign 0.00
R4747:Pcdhga3 UTSW 18 37676746 missense probably benign 0.29
R4964:Pcdhga3 UTSW 18 37676101 missense probably benign 0.05
R5165:Pcdhga3 UTSW 18 37675670 missense possibly damaging 0.60
R5210:Pcdhga3 UTSW 18 37675910 missense probably benign 0.03
R5370:Pcdhga3 UTSW 18 37675290 missense probably damaging 1.00
R5402:Pcdhga3 UTSW 18 37675694 missense probably benign 0.33
R5610:Pcdhga3 UTSW 18 37675223 missense possibly damaging 0.83
R5782:Pcdhga3 UTSW 18 37676300 missense possibly damaging 0.91
R6058:Pcdhga3 UTSW 18 37675088 missense probably damaging 1.00
R6127:Pcdhga3 UTSW 18 37674704 missense probably damaging 0.98
R6307:Pcdhga3 UTSW 18 37676621 unclassified probably null
R6893:Pcdhga3 UTSW 18 37676545 missense probably benign 0.37
R7013:Pcdhga3 UTSW 18 37675621 missense probably damaging 1.00
R7174:Pcdhga3 UTSW 18 37675927 missense probably benign 0.02
R7448:Pcdhga3 UTSW 18 37675864 missense possibly damaging 0.94
R7492:Pcdhga3 UTSW 18 37676125 missense probably benign 0.01
R7509:Pcdhga3 UTSW 18 37675857 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTCAGTAGGGCTGCACAC -3'
(R):5'- AGATCAGGTGACTCTTCCGAG -3'

Sequencing Primer
(F):5'- TGCTGGACAGAGATGCTCTC -3'
(R):5'- GAGCCTGCGGTAAGTGAAACTTC -3'
Posted On2017-02-15