Incidental Mutation 'R5889:Vldlr'
ID456251
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27239664 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000130382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably damaging
Transcript: ENSMUST00000025866
AA Change: I370N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: I370N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000047645
AA Change: I329N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: I329N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably benign
Transcript: ENSMUST00000164746
SMART Domains Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 69 1.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165761
AA Change: I39N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924
AA Change: I39N

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167487
AA Change: I370N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: I370N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172302
AA Change: I370N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: I370N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATAGCCGGAGACTGAATGTG -3'
(R):5'- GGCATTCATCAATATCTAGGAGGG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- CCAGGCTCTTTGCTTCAA -3'
Posted On2017-02-15