Incidental Mutation 'R5900:Dstyk'
ID456255
Institutional Source Beutler Lab
Gene Symbol Dstyk
Ensembl Gene ENSMUSG00000042046
Gene Namedual serine/threonine and tyrosine protein kinase
SynonymsC430014H23Rik, A930019K20Rik
MMRRC Submission 044099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5900 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132417555-132466958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132456979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 737 (R737Q)
Ref Sequence ENSEMBL: ENSMUSP00000139652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045110] [ENSMUST00000188389]
Predicted Effect probably damaging
Transcript: ENSMUST00000045110
AA Change: R737Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035358
Gene: ENSMUSG00000042046
AA Change: R737Q

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Pfam:Pkinase_Tyr 651 904 6.9e-37 PFAM
Pfam:Pkinase 651 905 5.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188006
Predicted Effect probably damaging
Transcript: ENSMUST00000188389
AA Change: R737Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046
AA Change: R737Q

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
S_TKc 650 859 2e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous knockout results in impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Abcc12 T C 8: 86,566,520 D13G possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Apoh G T 11: 108,412,017 K269N probably damaging Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Hkdc1 T C 10: 62,408,666 M214V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Mtus1 A T 8: 41,083,497 V394D possibly damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Serpina9 G A 12: 104,008,871 R8* probably null Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Znrf3 G T 11: 5,282,110 H468N probably damaging Het
Other mutations in Dstyk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dstyk APN 1 132459988 missense probably damaging 1.00
IGL01753:Dstyk APN 1 132462939 missense probably damaging 1.00
IGL02156:Dstyk APN 1 132449926 missense probably benign 0.27
IGL02175:Dstyk APN 1 132449391 nonsense probably null
IGL02721:Dstyk APN 1 132449316 missense probably benign 0.03
IGL03194:Dstyk APN 1 132456316 splice site probably benign
PIT4305001:Dstyk UTSW 1 132455896 nonsense probably null
PIT4791001:Dstyk UTSW 1 132449927 missense probably benign 0.00
R0135:Dstyk UTSW 1 132462934 missense probably damaging 1.00
R0309:Dstyk UTSW 1 132456864 splice site probably benign
R0399:Dstyk UTSW 1 132453080 splice site probably benign
R0781:Dstyk UTSW 1 132453325 splice site probably benign
R1110:Dstyk UTSW 1 132453325 splice site probably benign
R1138:Dstyk UTSW 1 132463486 missense probably benign 0.00
R1300:Dstyk UTSW 1 132449913 missense probably benign 0.02
R1330:Dstyk UTSW 1 132449880 missense probably benign 0.25
R1509:Dstyk UTSW 1 132456346 missense probably damaging 1.00
R1667:Dstyk UTSW 1 132456919 missense probably damaging 1.00
R1728:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1729:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1730:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1739:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1757:Dstyk UTSW 1 132434094 splice site probably benign
R1762:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1783:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1784:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1785:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1829:Dstyk UTSW 1 132449595 missense probably benign 0.06
R2031:Dstyk UTSW 1 132453191 missense probably damaging 0.99
R2124:Dstyk UTSW 1 132453119 missense possibly damaging 0.64
R2132:Dstyk UTSW 1 132449484 missense probably null
R2143:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2144:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2145:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R3804:Dstyk UTSW 1 132449726 missense probably damaging 1.00
R4277:Dstyk UTSW 1 132455413 splice site probably null
R4504:Dstyk UTSW 1 132434389 missense possibly damaging 0.81
R4674:Dstyk UTSW 1 132463390 missense probably benign 0.42
R4697:Dstyk UTSW 1 132449487 missense probably damaging 0.98
R4828:Dstyk UTSW 1 132434137 missense probably benign
R4940:Dstyk UTSW 1 132453106 missense probably damaging 0.96
R5029:Dstyk UTSW 1 132449324 missense probably benign 0.01
R5678:Dstyk UTSW 1 132453291 missense probably benign
R5935:Dstyk UTSW 1 132454137 missense probably damaging 0.99
R5973:Dstyk UTSW 1 132434411 missense probably damaging 0.99
R6217:Dstyk UTSW 1 132459939 missense probably damaging 1.00
R6381:Dstyk UTSW 1 132456765 intron probably null
R6429:Dstyk UTSW 1 132449804 nonsense probably null
R7038:Dstyk UTSW 1 132454109 missense probably benign 0.32
R7240:Dstyk UTSW 1 132454123 missense probably benign 0.02
R7411:Dstyk UTSW 1 132417666 missense probably benign 0.01
R7714:Dstyk UTSW 1 132456876 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACATCCTGGTATCTCATGCAGAG -3'
(R):5'- TGGAATGCAGAGCCTCTCAG -3'

Sequencing Primer
(F):5'- GTATCTCATGCAGAGTTAGAGCCC -3'
(R):5'- GGAATGCAGAGCCTCTCAGTATCTAC -3'
Posted On2017-02-15