Mutagenetix > Incidental Mutation

Incidental Mutation 'R5900:Clip2'

456264

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

Cyln2, WSCR4, CLIP-115

MMRRC Submission

044099-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R5900 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

134518237-134581288 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134531633 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 689 (D689G)

Ref Sequence

ENSEMBL: ENSMUSP00000037431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

AlphaFold

Q9Z0H8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036999
AA Change: D689G

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: D689G

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100647
AA Change: D724G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: D724G

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	A	11: 110,169,982 (GRCm39)	T1341S	possibly damaging	Het
Abcc12	T	C	8: 87,293,149 (GRCm39)	D13G	possibly damaging	Het
Adam24	T	C	8: 41,134,071 (GRCm39)	V513A	probably benign	Het
Adgrg6	C	T	10: 14,314,163 (GRCm39)		probably null	Het
Ankrd11	T	C	8: 123,617,805 (GRCm39)	T1995A	probably benign	Het
Apoh	G	T	11: 108,302,843 (GRCm39)	K269N	probably damaging	Het
Bahcc1	C	T	11: 120,175,319 (GRCm39)	L1798F	probably damaging	Het
Brca2	T	A	5: 150,464,597 (GRCm39)	C1454S	probably benign	Het
Cpa5	T	C	6: 30,615,115 (GRCm39)	V84A	probably damaging	Het
Ctsh	T	C	9: 89,946,621 (GRCm39)	I116T	probably damaging	Het
Dlg5	T	A	14: 24,199,515 (GRCm39)	E1463V	probably damaging	Het
Dnah11	C	T	12: 118,046,166 (GRCm39)		probably null	Het
Dstyk	G	A	1: 132,384,717 (GRCm39)	R737Q	probably damaging	Het
Galr1	A	G	18: 82,411,982 (GRCm39)	S295P	probably damaging	Het
Gpx2	A	G	12: 76,839,653 (GRCm39)	V115A	probably damaging	Het
Hhipl2	A	G	1: 183,207,597 (GRCm39)	I219V	possibly damaging	Het
Hkdc1	T	C	10: 62,244,445 (GRCm39)	M214V	possibly damaging	Het
Lrfn2	T	C	17: 49,377,291 (GRCm39)	V124A	possibly damaging	Het
Lrrcc1	T	G	3: 14,627,186 (GRCm39)	S704R	possibly damaging	Het
Marveld2	T	C	13: 100,748,176 (GRCm39)	Y301C	probably damaging	Het
Mcpt8	T	C	14: 56,319,740 (GRCm39)	I237V	probably damaging	Het
Mtus1	A	T	8: 41,536,534 (GRCm39)	V394D	possibly damaging	Het
Ncapd3	T	A	9: 26,978,265 (GRCm39)	D821E	probably benign	Het
Pcdh9	T	C	14: 93,564,156 (GRCm39)	D1058G	probably damaging	Het
Pld2	G	A	11: 70,446,888 (GRCm39)		probably null	Het
Prdm2	A	G	4: 142,861,290 (GRCm39)	S667P	probably damaging	Het
Ptgdr2	A	T	19: 10,918,352 (GRCm39)		probably null	Het
Rfx7	C	T	9: 72,524,538 (GRCm39)	T576I	probably benign	Het
Safb	T	C	17: 56,907,349 (GRCm39)	C426R	unknown	Het
Serpina9	G	A	12: 103,975,130 (GRCm39)	R8*	probably null	Het
Shank3	G	A	15: 89,387,593 (GRCm39)	R254Q	probably damaging	Het
Simc1	T	C	13: 54,694,837 (GRCm39)	V306A	probably damaging	Het
Srfbp1	A	G	18: 52,621,853 (GRCm39)	T305A	probably benign	Het
Tdrd5	A	T	1: 156,105,005 (GRCm39)	C463*	probably null	Het
Tmem132d	A	T	5: 128,346,336 (GRCm39)	L62Q	probably damaging	Het
Trank1	T	A	9: 111,220,784 (GRCm39)	L2507H	probably damaging	Het
Usp45	T	C	4: 21,830,451 (GRCm39)	V702A	probably damaging	Het
Wnk2	A	G	13: 49,256,308 (GRCm39)	I271T	probably damaging	Het
Zfp292	A	T	4: 34,805,125 (GRCm39)	L2640I	probably damaging	Het
Znrf3	G	T	11: 5,232,110 (GRCm39)	H468N	probably damaging	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134,529,011 (GRCm39)	splice site	probably benign
IGL01024:Clip2	APN	5	134,539,066 (GRCm39)	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134,521,204 (GRCm39)	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134,551,518 (GRCm39)	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134,526,938 (GRCm39)	splice site	probably benign
IGL02174:Clip2	APN	5	134,523,118 (GRCm39)	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134,531,984 (GRCm39)	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134,531,425 (GRCm39)	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134,546,876 (GRCm39)	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134,539,013 (GRCm39)	splice site	probably benign
IGL03198:Clip2	APN	5	134,526,936 (GRCm39)	splice site	probably benign
IGL03269:Clip2	APN	5	134,545,748 (GRCm39)	missense	probably damaging	1.00
scissors	UTSW	5	134,546,853 (GRCm39)	nonsense	probably null
R0335:Clip2	UTSW	5	134,564,069 (GRCm39)	start gained	probably benign
R0422:Clip2	UTSW	5	134,526,967 (GRCm39)	missense	probably benign	0.04
R0519:Clip2	UTSW	5	134,545,005 (GRCm39)	missense	probably benign	0.01
R1169:Clip2	UTSW	5	134,521,104 (GRCm39)	missense	probably benign	0.36
R1642:Clip2	UTSW	5	134,532,107 (GRCm39)	missense	possibly damaging	0.89
R1718:Clip2	UTSW	5	134,531,783 (GRCm39)	nonsense	probably null
R1822:Clip2	UTSW	5	134,532,081 (GRCm39)	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134,532,081 (GRCm39)	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134,531,969 (GRCm39)	missense	probably damaging	1.00
R3106:Clip2	UTSW	5	134,551,918 (GRCm39)	missense	probably benign	0.12
R3890:Clip2	UTSW	5	134,551,847 (GRCm39)	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134,551,847 (GRCm39)	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134,551,847 (GRCm39)	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134,521,107 (GRCm39)	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134,564,051 (GRCm39)	start gained	probably benign
R4239:Clip2	UTSW	5	134,564,051 (GRCm39)	start gained	probably benign
R4294:Clip2	UTSW	5	134,521,167 (GRCm39)	missense	probably benign	0.09
R4450:Clip2	UTSW	5	134,531,807 (GRCm39)	missense	possibly damaging	0.82
R4741:Clip2	UTSW	5	134,545,123 (GRCm39)	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5409:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134,542,902 (GRCm39)	missense	probably benign	0.01
R6464:Clip2	UTSW	5	134,520,779 (GRCm39)	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134,551,484 (GRCm39)	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134,525,095 (GRCm39)	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134,531,771 (GRCm39)	missense	probably benign	0.01
R7358:Clip2	UTSW	5	134,531,484 (GRCm39)	nonsense	probably null
R7725:Clip2	UTSW	5	134,546,853 (GRCm39)	nonsense	probably null
R8380:Clip2	UTSW	5	134,531,651 (GRCm39)	missense	probably damaging	0.96
R8680:Clip2	UTSW	5	134,531,462 (GRCm39)	missense	probably benign
R9095:Clip2	UTSW	5	134,532,254 (GRCm39)	missense	possibly damaging	0.93
R9158:Clip2	UTSW	5	134,521,251 (GRCm39)	missense	probably benign	0.00
R9277:Clip2	UTSW	5	134,528,963 (GRCm39)	missense	probably benign
R9300:Clip2	UTSW	5	134,526,942 (GRCm39)	critical splice donor site	probably null
R9457:Clip2	UTSW	5	134,531,584 (GRCm39)	missense	probably benign	0.00
R9491:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9605:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9630:Clip2	UTSW	5	134,531,934 (GRCm39)	missense	probably damaging	1.00
R9657:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9660:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9661:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9662:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9663:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9730:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9731:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9732:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9773:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9787:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9788:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
X0062:Clip2	UTSW	5	134,531,990 (GRCm39)	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134,551,853 (GRCm39)	missense	probably damaging	1.00
Z1177:Clip2	UTSW	5	134,545,689 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGAGTCTATTCTCAGCCACC -3'
(R):5'- CTGGAGTTAGGTAACCTGCAGG -3'

Sequencing Primer
(F):5'- AGAAGCTTTTCCCGCAGC -3'
(R):5'- TTAGGTAACCTGCAGGCCAAGC -3'

Posted On

2017-02-15