Incidental Mutation 'R5900:Mtus1'
ID456270
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
MMRRC Submission 044099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R5900 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41083497 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 394 (V394D)
Ref Sequence ENSEMBL: ENSMUSP00000119440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059115] [ENSMUST00000118835] [ENSMUST00000145860] [ENSMUST00000155055]
Predicted Effect probably benign
Transcript: ENSMUST00000059115
AA Change: V394D

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636
AA Change: V394D

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118835
AA Change: V394D

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636
AA Change: V394D

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143853
Predicted Effect possibly damaging
Transcript: ENSMUST00000145860
AA Change: V394D

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119440
Gene: ENSMUSG00000045636
AA Change: V394D

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155055
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Abcc12 T C 8: 86,566,520 D13G possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Apoh G T 11: 108,412,017 K269N probably damaging Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Dstyk G A 1: 132,456,979 R737Q probably damaging Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Hkdc1 T C 10: 62,408,666 M214V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Serpina9 G A 12: 104,008,871 R8* probably null Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Znrf3 G T 11: 5,282,110 H468N probably damaging Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0357:Mtus1 UTSW 8 41083526 missense possibly damaging 0.71
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R0681:Mtus1 UTSW 8 40993517 missense probably damaging 1.00
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2063:Mtus1 UTSW 8 41082708 missense probably damaging 1.00
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4940:Mtus1 UTSW 8 41041478 missense possibly damaging 0.52
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5860:Mtus1 UTSW 8 41076266 missense probably damaging 0.99
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7308:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R7424:Mtus1 UTSW 8 41022406 missense probably damaging 1.00
R7481:Mtus1 UTSW 8 41084615 missense probably damaging 0.99
R7485:Mtus1 UTSW 8 41084553 missense probably benign 0.37
R7660:Mtus1 UTSW 8 41016211 missense probably benign
R7699:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7700:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7709:Mtus1 UTSW 8 41054650 missense possibly damaging 0.81
R7791:Mtus1 UTSW 8 41083380 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTGCACGTTTAGCATCTCTTG -3'
(R):5'- CCGTATGCTCAACAGGAAATGG -3'

Sequencing Primer
(F):5'- GGTCCATTCTCCACATTATTGTAC -3'
(R):5'- TTTAAGAGGAACACTGCCCAACTG -3'
Posted On2017-02-15