Incidental Mutation 'R5900:Apoh'
ID 456283
Institutional Source Beutler Lab
Gene Symbol Apoh
Ensembl Gene ENSMUSG00000000049
Gene Name apolipoprotein H
Synonyms beta-2-GPI, beta-2-glycoprotein 1, B2GPI
MMRRC Submission 044099-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock # R5900 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 108343354-108414396 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108412017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 269 (K269N)
Ref Sequence ENSEMBL: ENSMUSP00000000049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000049] [ENSMUST00000152958]
AlphaFold Q01339
Predicted Effect probably damaging
Transcript: ENSMUST00000000049
AA Change: K269N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000049
Gene: ENSMUSG00000000049
AA Change: K269N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
CCP 142 200 4.92e-10 SMART
CCP 205 260 1.98e-14 SMART
CCP 264 325 2.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152958
SMART Domains Protein: ENSMUSP00000114214
Gene: ENSMUSG00000000049

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced viability and reduced thrombin production. Only 8% homozygous null animals are born from heterozygous intercrosses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Abcc12 T C 8: 86,566,520 D13G possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Dstyk G A 1: 132,456,979 R737Q probably damaging Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Hkdc1 T C 10: 62,408,666 M214V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Mtus1 A T 8: 41,083,497 V394D possibly damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Serpina9 G A 12: 104,008,871 R8* probably null Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Znrf3 G T 11: 5,282,110 H468N probably damaging Het
Other mutations in Apoh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Apoh APN 11 108395834 missense probably benign 0.45
IGL01327:Apoh APN 11 108397361 missense probably damaging 1.00
IGL01353:Apoh APN 11 108397385 missense probably damaging 1.00
IGL01464:Apoh APN 11 108395890 missense probably damaging 1.00
IGL02065:Apoh APN 11 108414305 utr 3 prime probably benign
IGL02646:Apoh APN 11 108412142 missense probably benign 0.15
R0125:Apoh UTSW 11 108412073 missense probably damaging 1.00
R0359:Apoh UTSW 11 108397373 missense probably damaging 1.00
R1969:Apoh UTSW 11 108407462 missense probably benign 0.00
R2280:Apoh UTSW 11 108409180 nonsense probably null
R2568:Apoh UTSW 11 108404871 missense probably benign 0.00
R4369:Apoh UTSW 11 108397379 missense probably damaging 1.00
R4789:Apoh UTSW 11 108409238 missense probably damaging 1.00
R4824:Apoh UTSW 11 108414261 missense probably benign 0.37
R4937:Apoh UTSW 11 108407378 missense probably benign 0.19
R5634:Apoh UTSW 11 108412049 missense probably damaging 1.00
R5951:Apoh UTSW 11 108395903 missense probably damaging 1.00
R6054:Apoh UTSW 11 108395975 missense probably damaging 1.00
R6126:Apoh UTSW 11 108397373 missense probably damaging 1.00
R7343:Apoh UTSW 11 108395848 missense probably benign 0.14
R7471:Apoh UTSW 11 108407305 missense probably damaging 1.00
R8557:Apoh UTSW 11 108409236 missense probably damaging 0.99
R9310:Apoh UTSW 11 108407481 critical splice donor site probably null
R9671:Apoh UTSW 11 108395966 nonsense probably null
X0065:Apoh UTSW 11 108395350 missense probably damaging 1.00
Z1176:Apoh UTSW 11 108343459 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGACCTACATGTGGATGTCAC -3'
(R):5'- CCTTGAAGCACGAGGGAATCTC -3'

Sequencing Primer
(F):5'- TGGGCTCACATGCATCATG -3'
(R):5'- AGGGAATCTCGATAGTGCCATCTC -3'
Posted On 2017-02-15