Incidental Mutation 'R5901:Xkr4'
ID456304
Institutional Source Beutler Lab
Gene Symbol Xkr4
Ensembl Gene ENSMUSG00000051951
Gene NameX-linked Kx blood group related 4
Synonyms
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location3205901-3671498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3216678 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 430 (F430I)
Ref Sequence ENSEMBL: ENSMUSP00000070648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070533]
Predicted Effect probably damaging
Transcript: ENSMUST00000070533
AA Change: F430I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070648
Gene: ENSMUSG00000051951
AA Change: F430I

DomainStartEndE-ValueType
low complexity region 49 99 N/A INTRINSIC
Pfam:XK-related 111 513 2.6e-128 PFAM
low complexity region 573 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162897
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Xkr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Xkr4 APN 1 3216575 missense probably damaging 1.00
R0200:Xkr4 UTSW 1 3670663 missense probably benign 0.00
R0829:Xkr4 UTSW 1 3671246 missense possibly damaging 0.59
R0830:Xkr4 UTSW 1 3670745 missense possibly damaging 0.48
R0959:Xkr4 UTSW 1 3216674 missense probably damaging 1.00
R1242:Xkr4 UTSW 1 3216137 missense probably damaging 1.00
R1257:Xkr4 UTSW 1 3216813 missense probably benign 0.29
R2002:Xkr4 UTSW 1 3671095 missense probably benign
R3896:Xkr4 UTSW 1 3216191 missense probably damaging 0.99
R4006:Xkr4 UTSW 1 3421775 missense probably benign 0.01
R4173:Xkr4 UTSW 1 3216488 missense probably damaging 1.00
R4770:Xkr4 UTSW 1 3216491 missense probably damaging 1.00
R4868:Xkr4 UTSW 1 3216851 missense probably damaging 1.00
R5103:Xkr4 UTSW 1 3670688 missense probably benign
R5548:Xkr4 UTSW 1 3216930 missense probably damaging 1.00
R5602:Xkr4 UTSW 1 3216528 missense probably benign 0.18
R5608:Xkr4 UTSW 1 3671380 start gained probably benign
R5668:Xkr4 UTSW 1 3671035 missense probably damaging 1.00
R6296:Xkr4 UTSW 1 3216570 missense probably benign 0.01
R6302:Xkr4 UTSW 1 3216738 missense probably damaging 0.99
R6326:Xkr4 UTSW 1 3671038 missense possibly damaging 0.75
R6341:Xkr4 UTSW 1 3670778 missense probably benign
R6911:Xkr4 UTSW 1 3671321 missense possibly damaging 0.91
R7086:Xkr4 UTSW 1 3216962 missense probably damaging 1.00
R7249:Xkr4 UTSW 1 3216810 missense probably damaging 1.00
R7571:Xkr4 UTSW 1 3670688 missense probably benign 0.00
R7881:Xkr4 UTSW 1 3216264 missense probably damaging 1.00
R7952:Xkr4 UTSW 1 3670619 missense possibly damaging 0.94
R8332:Xkr4 UTSW 1 3421899 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670981 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGGCAAATGCATCTGC -3'
(R):5'- TCCTACCAGAAGGCTCTTCG -3'

Sequencing Primer
(F):5'- CATCTGCAATCTGGGGAGC -3'
(R):5'- AGCTACATGGCTGTCATCATTCAG -3'
Posted On2017-02-15