Incidental Mutation 'R5901:Rad54b'
ID456309
Institutional Source Beutler Lab
Gene Symbol Rad54b
Ensembl Gene ENSMUSG00000078773
Gene NameRAD54 homolog B (S. cerevisiae)
SynonymsE130016E03Rik, E130016E03Rik
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11558922-11615805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11595919 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 232 (R232H)
Ref Sequence ENSEMBL: ENSMUSP00000066977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070755
AA Change: R232H

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: R232H

DomainStartEndE-ValueType
low complexity region 113 121 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
DEXDc 270 470 4.36e-36 SMART
HELICc 652 736 6.14e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178725
AA Change: R9H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179731
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Rad54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Rad54b APN 4 11593765 missense probably benign
IGL00774:Rad54b APN 4 11593765 missense probably benign
IGL00956:Rad54b APN 4 11597833 missense probably damaging 0.98
IGL00961:Rad54b APN 4 11599699 missense probably damaging 1.00
IGL01064:Rad54b APN 4 11604866 missense probably damaging 1.00
IGL02150:Rad54b APN 4 11610502 missense probably damaging 1.00
IGL02326:Rad54b APN 4 11612713 missense probably damaging 1.00
IGL03105:Rad54b APN 4 11615569 missense probably benign 0.00
IGL03143:Rad54b APN 4 11599755 missense probably damaging 1.00
IGL03288:Rad54b APN 4 11569833 missense possibly damaging 0.83
P0033:Rad54b UTSW 4 11609285 unclassified probably benign
R0076:Rad54b UTSW 4 11609480 unclassified probably benign
R0094:Rad54b UTSW 4 11599681 missense possibly damaging 0.92
R0391:Rad54b UTSW 4 11601702 missense probably damaging 0.98
R0441:Rad54b UTSW 4 11563394 missense probably benign 0.08
R0442:Rad54b UTSW 4 11609480 unclassified probably benign
R0442:Rad54b UTSW 4 11610362 missense probably benign 0.02
R0449:Rad54b UTSW 4 11606131 missense probably benign 0.43
R0519:Rad54b UTSW 4 11599809 missense probably damaging 1.00
R0843:Rad54b UTSW 4 11609471 critical splice donor site probably null
R1118:Rad54b UTSW 4 11563352 missense probably damaging 1.00
R1439:Rad54b UTSW 4 11606152 missense possibly damaging 0.90
R1763:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R1812:Rad54b UTSW 4 11612770 missense probably damaging 1.00
R1854:Rad54b UTSW 4 11601669 missense probably damaging 1.00
R1917:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1918:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1919:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R2057:Rad54b UTSW 4 11606088 missense probably benign 0.08
R2386:Rad54b UTSW 4 11597874 missense probably benign
R2437:Rad54b UTSW 4 11606272 missense probably damaging 1.00
R4299:Rad54b UTSW 4 11597865 missense probably damaging 1.00
R4391:Rad54b UTSW 4 11615570 missense probably benign 0.00
R4672:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4673:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4826:Rad54b UTSW 4 11599753 missense probably damaging 1.00
R4930:Rad54b UTSW 4 11615579 missense probably damaging 0.99
R5796:Rad54b UTSW 4 11615446 missense probably benign 0.01
R6185:Rad54b UTSW 4 11593804 missense possibly damaging 0.51
R6355:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R6576:Rad54b UTSW 4 11601577 missense probably benign
R6684:Rad54b UTSW 4 11583689 unclassified probably benign
R6821:Rad54b UTSW 4 11612777 missense probably damaging 1.00
R6947:Rad54b UTSW 4 11569859 missense possibly damaging 0.83
R7177:Rad54b UTSW 4 11599755 missense probably damaging 1.00
R7361:Rad54b UTSW 4 11599782 missense probably damaging 1.00
R7483:Rad54b UTSW 4 11610372 missense probably damaging 1.00
R7511:Rad54b UTSW 4 11578956 splice site probably null
R7847:Rad54b UTSW 4 11612655 missense probably damaging 1.00
R7908:Rad54b UTSW 4 11595868 missense probably null 0.01
R8198:Rad54b UTSW 4 11612440 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGGACAATCTCTTCTGATGAC -3'
(R):5'- CATGTCAAAACCCTTTAGACAGTAG -3'

Sequencing Primer
(F):5'- TCTGATGACTTCAACAGTGGC -3'
(R):5'- CTTTAATCCCAGGACTCAGGAGG -3'
Posted On2017-02-15