Incidental Mutation 'R5901:Kif17'
ID456312
Institutional Source Beutler Lab
Gene Symbol Kif17
Ensembl Gene ENSMUSG00000028758
Gene Namekinesin family member 17
SynonymsN-4 kinesin, 5930435E01Rik, Kif17b
MMRRC Submission 043239-MU
Accession Numbers

Genbank: NM_010623; MGI: 1098229

Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5901 (G1)
Quality Score195
Status Not validated
Chromosome4
Chromosomal Location138250435-138301967 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 138298332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105821]
Predicted Effect probably null
Transcript: ENSMUST00000030539
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105818
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105821
SMART Domains Protein: ENSMUSP00000101447
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
low complexity region 486 499 N/A INTRINSIC
coiled coil region 569 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired anterograde neuron transport, reduced NMDA-mediated synaptic currents, impaired synaptic plasticity, impaired long term object recognition memory, impaired spatial learning, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Kif17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Kif17 APN 4 138262708 missense possibly damaging 0.66
IGL00973:Kif17 APN 4 138275057 missense probably benign 0.06
IGL01527:Kif17 APN 4 138269086 missense probably benign 0.21
IGL01559:Kif17 APN 4 138293769 missense probably damaging 0.99
IGL01736:Kif17 APN 4 138286565 missense possibly damaging 0.96
IGL02671:Kif17 APN 4 138288061 missense possibly damaging 0.85
IGL02976:Kif17 APN 4 138269063 missense probably damaging 1.00
IGL03051:Kif17 APN 4 138289254 missense probably damaging 0.99
IGL03285:Kif17 APN 4 138268990 missense probably damaging 0.97
easy_company UTSW 4 138288332 nonsense probably null
fiddle UTSW 4 138286480 missense probably benign 0.18
fidget UTSW 4 138269891 missense probably damaging 1.00
A5278:Kif17 UTSW 4 138287950 missense probably benign 0.33
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0133:Kif17 UTSW 4 138278245 missense possibly damaging 0.73
R0627:Kif17 UTSW 4 138288487 critical splice donor site probably null
R0670:Kif17 UTSW 4 138262499 unclassified probably benign
R0894:Kif17 UTSW 4 138298231 missense possibly damaging 0.93
R1367:Kif17 UTSW 4 138277994 nonsense probably null
R1648:Kif17 UTSW 4 138269895 missense probably damaging 1.00
R1674:Kif17 UTSW 4 138301258 missense probably benign 0.13
R1700:Kif17 UTSW 4 138262698 nonsense probably null
R1855:Kif17 UTSW 4 138288271 missense probably benign 0.44
R2137:Kif17 UTSW 4 138262667 missense probably damaging 0.98
R2170:Kif17 UTSW 4 138288371 missense probably benign 0.01
R3008:Kif17 UTSW 4 138278165 missense probably damaging 1.00
R3855:Kif17 UTSW 4 138291510 missense probably benign 0.18
R4591:Kif17 UTSW 4 138277799 missense probably benign 0.06
R4789:Kif17 UTSW 4 138281377 missense probably damaging 1.00
R5407:Kif17 UTSW 4 138298221 missense probably damaging 1.00
R5859:Kif17 UTSW 4 138291433 missense possibly damaging 0.71
R5919:Kif17 UTSW 4 138269891 missense probably damaging 1.00
R6119:Kif17 UTSW 4 138288332 nonsense probably null
R6312:Kif17 UTSW 4 138288193 missense probably benign 0.40
R6693:Kif17 UTSW 4 138286480 missense probably benign 0.18
R6774:Kif17 UTSW 4 138274995 missense probably damaging 1.00
R6838:Kif17 UTSW 4 138278399 splice site probably null
R6863:Kif17 UTSW 4 138269884 nonsense probably null
R7205:Kif17 UTSW 4 138293766 missense probably benign 0.21
R7307:Kif17 UTSW 4 138262643 missense probably benign 0.00
R7336:Kif17 UTSW 4 138298306 missense possibly damaging 0.76
R7594:Kif17 UTSW 4 138277925 missense probably damaging 1.00
R7806:Kif17 UTSW 4 138288196 missense possibly damaging 0.71
R8019:Kif17 UTSW 4 138296225 missense probably benign 0.17
R8306:Kif17 UTSW 4 138277909 missense probably damaging 0.99
Z1177:Kif17 UTSW 4 138287930 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGATGTCCAGCACCAAATGG -3'
(R):5'- ATGACCTATTATGTGGCCCCATTTC -3'

Sequencing Primer
(F):5'- TCCCCACAAGCTCTAGGGTC -3'
(R):5'- ATTATGTGGCCCCATTTCTCTGC -3'
Posted On2017-02-15