Incidental Mutation 'R5901:Otof'
ID 456316
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Name otoferlin
Synonyms
MMRRC Submission 043239-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5901 (G1)
Quality Score 207
Status Not validated
Chromosome 5
Chromosomal Location 30524406-30619276 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30532323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1603 (D1603G)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074171
AA Change: D1608G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: D1608G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114747
AA Change: D1603G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: D1603G

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,728,163 (GRCm39) S227C unknown Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adamts15 C T 9: 30,813,786 (GRCm39) R793H probably damaging Het
Ankra2 A G 13: 98,407,644 (GRCm39) E38G probably damaging Het
Aqp8 G A 7: 123,061,807 (GRCm39) C8Y probably damaging Het
Atg9b A G 5: 24,597,017 (GRCm39) probably benign Het
Atp6v1b1 A G 6: 83,735,339 (GRCm39) E469G possibly damaging Het
B4gat1 T A 19: 5,089,241 (GRCm39) Y79* probably null Het
BB019430 T A 10: 58,540,014 (GRCm39) noncoding transcript Het
Calhm3 T C 19: 47,146,052 (GRCm39) Y51C probably damaging Het
Ccr2 C T 9: 123,906,239 (GRCm39) T173I possibly damaging Het
Cfap43 T C 19: 47,885,538 (GRCm39) D359G probably damaging Het
Dop1b A G 16: 93,566,639 (GRCm39) E1022G possibly damaging Het
Drd2 T A 9: 49,318,259 (GRCm39) C400* probably null Het
Efcab7 T A 4: 99,766,941 (GRCm39) H495Q probably damaging Het
Faim T C 9: 98,874,195 (GRCm39) V29A probably benign Het
Fancd2 T C 6: 113,526,326 (GRCm39) S350P probably damaging Het
Fbxw16 T C 9: 109,270,285 (GRCm39) E152G probably benign Het
Kif17 T C 4: 138,025,643 (GRCm39) probably null Het
Kif24 A T 4: 41,428,604 (GRCm39) S119T probably damaging Het
Ly6k A T 15: 74,670,429 (GRCm39) S38T probably benign Het
Mapk10 A G 5: 103,061,158 (GRCm39) S430P probably damaging Het
Megf10 G A 18: 57,410,180 (GRCm39) A654T probably benign Het
Mlph T C 1: 90,867,536 (GRCm39) L450P probably damaging Het
Pdcd11 T C 19: 47,116,771 (GRCm39) S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 (GRCm39) R232H possibly damaging Het
Sar1b C T 11: 51,670,576 (GRCm39) T40I possibly damaging Het
Scyl2 C T 10: 89,496,124 (GRCm39) S242N probably benign Het
Sema4b A G 7: 79,874,715 (GRCm39) N702D possibly damaging Het
Slc16a11 A G 11: 70,107,172 (GRCm39) I394V probably benign Het
Stard9 A C 2: 120,531,851 (GRCm39) T2703P probably damaging Het
Stat5b A T 11: 100,695,733 (GRCm39) L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,932 (GRCm39) V166D possibly damaging Het
Tmem117 T A 15: 94,612,839 (GRCm39) I125N probably benign Het
Tmem39a T C 16: 38,393,568 (GRCm39) I89T probably benign Het
Ubr4 T A 4: 139,178,565 (GRCm39) H3272Q probably damaging Het
Vmn1r7 T C 6: 57,001,591 (GRCm39) E223G probably damaging Het
Vmn2r78 T C 7: 86,603,796 (GRCm39) V658A probably damaging Het
Xirp2 A T 2: 67,343,410 (GRCm39) T1884S possibly damaging Het
Xkr4 A T 1: 3,286,901 (GRCm39) F430I probably damaging Het
Yae1d1 A G 13: 18,164,200 (GRCm39) M1T probably null Het
Zfand4 T C 6: 116,265,084 (GRCm39) V183A probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30,533,248 (GRCm39) missense probably damaging 1.00
IGL00391:Otof APN 5 30,532,967 (GRCm39) missense probably damaging 1.00
IGL00579:Otof APN 5 30,556,666 (GRCm39) missense possibly damaging 0.88
IGL00671:Otof APN 5 30,543,097 (GRCm39) critical splice donor site probably null
IGL01019:Otof APN 5 30,562,560 (GRCm39) missense probably benign 0.01
IGL01025:Otof APN 5 30,541,597 (GRCm39) missense possibly damaging 0.82
IGL01086:Otof APN 5 30,533,617 (GRCm39) critical splice donor site probably null
IGL01110:Otof APN 5 30,619,069 (GRCm39) missense probably damaging 1.00
IGL01160:Otof APN 5 30,538,879 (GRCm39) missense probably benign 0.00
IGL01285:Otof APN 5 30,562,527 (GRCm39) missense probably damaging 1.00
IGL01329:Otof APN 5 30,598,723 (GRCm39) missense probably benign 0.00
IGL01337:Otof APN 5 30,576,856 (GRCm39) missense probably benign 0.17
IGL01337:Otof APN 5 30,563,121 (GRCm39) missense possibly damaging 0.93
IGL01834:Otof APN 5 30,556,564 (GRCm39) missense probably damaging 1.00
IGL01872:Otof APN 5 30,536,598 (GRCm39) splice site probably benign
IGL01969:Otof APN 5 30,539,827 (GRCm39) splice site probably benign
IGL02075:Otof APN 5 30,528,070 (GRCm39) missense probably benign 0.23
IGL02077:Otof APN 5 30,556,579 (GRCm39) missense probably damaging 1.00
IGL02136:Otof APN 5 30,531,336 (GRCm39) missense possibly damaging 0.90
IGL02227:Otof APN 5 30,528,128 (GRCm39) missense probably damaging 1.00
IGL02475:Otof APN 5 30,534,026 (GRCm39) missense probably damaging 1.00
IGL02812:Otof APN 5 30,531,426 (GRCm39) missense probably benign 0.08
IGL02864:Otof APN 5 30,543,685 (GRCm39) missense probably damaging 0.99
IGL03176:Otof APN 5 30,562,520 (GRCm39) splice site probably null
R0285:Otof UTSW 5 30,536,877 (GRCm39) critical splice donor site probably null
R0421:Otof UTSW 5 30,528,912 (GRCm39) missense possibly damaging 0.94
R0570:Otof UTSW 5 30,529,225 (GRCm39) splice site probably benign
R0599:Otof UTSW 5 30,528,049 (GRCm39) missense probably damaging 1.00
R0675:Otof UTSW 5 30,539,705 (GRCm39) missense probably benign 0.01
R0715:Otof UTSW 5 30,552,041 (GRCm39) missense probably damaging 0.99
R1019:Otof UTSW 5 30,528,087 (GRCm39) missense probably damaging 0.96
R1183:Otof UTSW 5 30,529,256 (GRCm39) missense probably damaging 1.00
R1435:Otof UTSW 5 30,536,039 (GRCm39) missense probably benign 0.00
R1469:Otof UTSW 5 30,537,571 (GRCm39) missense probably benign 0.00
R1469:Otof UTSW 5 30,537,571 (GRCm39) missense probably benign 0.00
R1474:Otof UTSW 5 30,536,876 (GRCm39) critical splice donor site probably null
R1524:Otof UTSW 5 30,536,900 (GRCm39) missense probably benign 0.03
R1563:Otof UTSW 5 30,528,349 (GRCm39) missense probably benign 0.00
R1732:Otof UTSW 5 30,543,815 (GRCm39) missense probably damaging 1.00
R1822:Otof UTSW 5 30,536,054 (GRCm39) missense probably benign 0.00
R1845:Otof UTSW 5 30,529,067 (GRCm39) nonsense probably null
R1925:Otof UTSW 5 30,551,532 (GRCm39) missense probably benign 0.37
R1938:Otof UTSW 5 30,533,713 (GRCm39) missense probably benign 0.00
R1968:Otof UTSW 5 30,545,998 (GRCm39) missense probably damaging 1.00
R1996:Otof UTSW 5 30,578,381 (GRCm39) missense probably benign 0.01
R1999:Otof UTSW 5 30,546,116 (GRCm39) missense probably benign 0.19
R2027:Otof UTSW 5 30,578,358 (GRCm39) missense probably benign 0.08
R2138:Otof UTSW 5 30,619,114 (GRCm39) missense probably benign 0.01
R2173:Otof UTSW 5 30,543,718 (GRCm39) missense probably damaging 1.00
R2245:Otof UTSW 5 30,527,551 (GRCm39) missense probably damaging 1.00
R3011:Otof UTSW 5 30,540,184 (GRCm39) missense probably damaging 1.00
R3105:Otof UTSW 5 30,539,145 (GRCm39) missense probably benign 0.03
R3442:Otof UTSW 5 30,529,033 (GRCm39) missense probably damaging 1.00
R3710:Otof UTSW 5 30,542,610 (GRCm39) missense probably benign
R3715:Otof UTSW 5 30,534,215 (GRCm39) nonsense probably null
R3806:Otof UTSW 5 30,543,843 (GRCm39) critical splice acceptor site probably null
R3975:Otof UTSW 5 30,528,056 (GRCm39) missense probably damaging 1.00
R4067:Otof UTSW 5 30,556,635 (GRCm39) missense probably damaging 1.00
R4077:Otof UTSW 5 30,576,850 (GRCm39) missense possibly damaging 0.89
R4166:Otof UTSW 5 30,539,762 (GRCm39) missense probably damaging 1.00
R4451:Otof UTSW 5 30,542,508 (GRCm39) missense possibly damaging 0.77
R4485:Otof UTSW 5 30,532,344 (GRCm39) missense possibly damaging 0.77
R4600:Otof UTSW 5 30,529,244 (GRCm39) missense probably damaging 1.00
R4646:Otof UTSW 5 30,540,914 (GRCm39) missense possibly damaging 0.82
R4648:Otof UTSW 5 30,540,914 (GRCm39) missense possibly damaging 0.82
R4669:Otof UTSW 5 30,578,318 (GRCm39) critical splice donor site probably null
R4773:Otof UTSW 5 30,552,026 (GRCm39) missense probably benign 0.05
R4839:Otof UTSW 5 30,576,748 (GRCm39) missense probably damaging 0.99
R4907:Otof UTSW 5 30,536,005 (GRCm39) critical splice donor site probably null
R4961:Otof UTSW 5 30,540,837 (GRCm39) intron probably benign
R4991:Otof UTSW 5 30,551,525 (GRCm39) missense probably damaging 1.00
R5015:Otof UTSW 5 30,540,238 (GRCm39) missense probably damaging 1.00
R5036:Otof UTSW 5 30,541,783 (GRCm39) missense possibly damaging 0.54
R5038:Otof UTSW 5 30,541,783 (GRCm39) missense possibly damaging 0.54
R5253:Otof UTSW 5 30,527,483 (GRCm39) missense probably damaging 1.00
R5336:Otof UTSW 5 30,534,064 (GRCm39) missense probably benign 0.01
R5365:Otof UTSW 5 30,539,144 (GRCm39) missense probably damaging 0.99
R6211:Otof UTSW 5 30,529,244 (GRCm39) missense probably damaging 0.99
R6318:Otof UTSW 5 30,571,888 (GRCm39) missense probably damaging 1.00
R6331:Otof UTSW 5 30,529,279 (GRCm39) missense possibly damaging 0.94
R6671:Otof UTSW 5 30,576,877 (GRCm39) missense probably benign
R6701:Otof UTSW 5 30,528,141 (GRCm39) nonsense probably null
R6792:Otof UTSW 5 30,532,978 (GRCm39) missense probably damaging 1.00
R6853:Otof UTSW 5 30,545,583 (GRCm39) missense probably damaging 1.00
R6940:Otof UTSW 5 30,528,987 (GRCm39) missense probably damaging 0.96
R7037:Otof UTSW 5 30,538,882 (GRCm39) missense probably benign 0.32
R7060:Otof UTSW 5 30,545,700 (GRCm39) missense possibly damaging 0.84
R7089:Otof UTSW 5 30,528,912 (GRCm39) missense possibly damaging 0.94
R7165:Otof UTSW 5 30,532,964 (GRCm39) missense probably damaging 0.99
R7178:Otof UTSW 5 30,540,878 (GRCm39) missense possibly damaging 0.50
R7298:Otof UTSW 5 30,545,614 (GRCm39) missense probably damaging 1.00
R7393:Otof UTSW 5 30,527,614 (GRCm39) missense probably benign 0.45
R7397:Otof UTSW 5 30,533,051 (GRCm39) missense probably damaging 1.00
R7400:Otof UTSW 5 30,542,532 (GRCm39) missense probably benign 0.04
R7428:Otof UTSW 5 30,547,169 (GRCm39) missense probably damaging 1.00
R7456:Otof UTSW 5 30,552,005 (GRCm39) missense probably damaging 1.00
R7505:Otof UTSW 5 30,528,364 (GRCm39) missense probably benign 0.00
R7714:Otof UTSW 5 30,527,597 (GRCm39) missense probably damaging 0.99
R8002:Otof UTSW 5 30,537,954 (GRCm39) missense probably benign 0.10
R8032:Otof UTSW 5 30,619,142 (GRCm39) start codon destroyed probably benign 0.07
R8153:Otof UTSW 5 30,546,079 (GRCm39) missense probably damaging 1.00
R8158:Otof UTSW 5 30,537,538 (GRCm39) missense probably benign 0.37
R8159:Otof UTSW 5 30,537,538 (GRCm39) missense probably benign 0.37
R8441:Otof UTSW 5 30,538,200 (GRCm39) missense probably damaging 0.99
R8738:Otof UTSW 5 30,545,968 (GRCm39) nonsense probably null
R8813:Otof UTSW 5 30,540,242 (GRCm39) missense probably benign 0.02
R8835:Otof UTSW 5 30,528,264 (GRCm39) missense probably benign 0.44
R8852:Otof UTSW 5 30,529,044 (GRCm39) missense possibly damaging 0.94
R8869:Otof UTSW 5 30,578,325 (GRCm39) missense probably benign 0.08
R9029:Otof UTSW 5 30,527,419 (GRCm39) critical splice donor site probably null
R9031:Otof UTSW 5 30,537,532 (GRCm39) missense probably benign
R9061:Otof UTSW 5 30,546,001 (GRCm39) missense possibly damaging 0.50
R9100:Otof UTSW 5 30,539,696 (GRCm39) missense possibly damaging 0.80
R9121:Otof UTSW 5 30,536,462 (GRCm39) missense probably benign 0.04
R9188:Otof UTSW 5 30,534,095 (GRCm39) missense probably damaging 1.00
R9218:Otof UTSW 5 30,542,469 (GRCm39) missense probably benign
R9280:Otof UTSW 5 30,528,894 (GRCm39) missense probably damaging 0.98
R9395:Otof UTSW 5 30,532,976 (GRCm39) missense probably damaging 1.00
R9400:Otof UTSW 5 30,540,863 (GRCm39) critical splice donor site probably null
R9407:Otof UTSW 5 30,538,265 (GRCm39) missense probably damaging 1.00
R9616:Otof UTSW 5 30,539,708 (GRCm39) missense possibly damaging 0.95
R9665:Otof UTSW 5 30,584,895 (GRCm39) missense probably benign 0.22
R9748:Otof UTSW 5 30,540,998 (GRCm39) missense probably damaging 1.00
R9783:Otof UTSW 5 30,536,576 (GRCm39) missense probably benign
Z1176:Otof UTSW 5 30,528,930 (GRCm39) missense probably damaging 0.98
Z1177:Otof UTSW 5 30,541,002 (GRCm39) missense probably damaging 1.00
Z1177:Otof UTSW 5 30,533,641 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGTCACTAGAGGACATC -3'
(R):5'- CCAGCAGCCCTAGTATCTTG -3'

Sequencing Primer
(F):5'- CCATAGAGAAGTGTGGCTCTC -3'
(R):5'- CAGCCCTAGTATCTTGGGTGAAGC -3'
Posted On 2017-02-15