Incidental Mutation 'R5901:Atp6v1b1'
ID456319
Institutional Source Beutler Lab
Gene Symbol Atp6v1b1
Ensembl Gene ENSMUSG00000006269
Gene NameATPase, H+ transporting, lysosomal V1 subunit B1
SynonymsAtp6b1, Vpp-3, D630039P21Rik, lysosomal 56/58kDa, Vpp3, D630030L16Rik
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83742990-83758855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83758357 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 469 (E469G)
Ref Sequence ENSEMBL: ENSMUSP00000006431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006431] [ENSMUST00000014891] [ENSMUST00000205763] [ENSMUST00000206496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006431
AA Change: E469G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006431
Gene: ENSMUSG00000006269
AA Change: E469G

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 44 110 1.9e-14 PFAM
Pfam:ATP-synt_ab 167 393 9.4e-68 PFAM
Pfam:ATP-synt_ab_C 410 508 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000014891
SMART Domains Protein: ENSMUSP00000014891
Gene: ENSMUSG00000014747

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
ANK 110 140 1.15e0 SMART
ANK 144 177 1.63e0 SMART
ANK 181 210 1.78e-6 SMART
Blast:ANK 215 243 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190077
Predicted Effect probably benign
Transcript: ENSMUST00000205763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206052
Predicted Effect probably benign
Transcript: ENSMUST00000206496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206652
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show impaired urinary acidification with a more severe metabolic acidosis and inappropriately alkaline urine after oral acid challenge. However, contrary to expectation, neither hearing nor inner ear morphology areimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Atp6v1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Atp6v1b1 APN 6 83749915 splice site probably benign
IGL02005:Atp6v1b1 APN 6 83753914 unclassified probably benign
IGL02085:Atp6v1b1 APN 6 83753915 unclassified probably benign
IGL02100:Atp6v1b1 APN 6 83758444 missense probably damaging 1.00
IGL02267:Atp6v1b1 APN 6 83756909 missense probably benign 0.44
IGL02507:Atp6v1b1 APN 6 83756855 missense possibly damaging 0.95
IGL02563:Atp6v1b1 APN 6 83755451 missense probably benign 0.14
IGL03144:Atp6v1b1 APN 6 83758351 missense probably benign 0.02
R0391:Atp6v1b1 UTSW 6 83756921 missense possibly damaging 0.93
R0420:Atp6v1b1 UTSW 6 83752844 unclassified probably benign
R0458:Atp6v1b1 UTSW 6 83752408 missense probably damaging 1.00
R0561:Atp6v1b1 UTSW 6 83753811 missense probably damaging 1.00
R0947:Atp6v1b1 UTSW 6 83753832 missense probably damaging 1.00
R1241:Atp6v1b1 UTSW 6 83756544 unclassified probably benign
R1417:Atp6v1b1 UTSW 6 83753880 missense probably damaging 1.00
R1447:Atp6v1b1 UTSW 6 83757942 missense possibly damaging 0.46
R1710:Atp6v1b1 UTSW 6 83758390 missense probably benign
R1722:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.68
R1862:Atp6v1b1 UTSW 6 83749852 critical splice acceptor site probably null
R2086:Atp6v1b1 UTSW 6 83757852 missense probably benign 0.10
R3433:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.81
R4193:Atp6v1b1 UTSW 6 83743103 missense probably benign 0.01
R4606:Atp6v1b1 UTSW 6 83752461 missense probably damaging 1.00
R6156:Atp6v1b1 UTSW 6 83758133 missense probably damaging 1.00
R6187:Atp6v1b1 UTSW 6 83752395 missense probably damaging 1.00
R6717:Atp6v1b1 UTSW 6 83753650 splice site probably null
R6727:Atp6v1b1 UTSW 6 83751875 unclassified probably benign
R6952:Atp6v1b1 UTSW 6 83754810 missense probably damaging 1.00
R7753:Atp6v1b1 UTSW 6 83752458 missense probably benign 0.02
R7852:Atp6v1b1 UTSW 6 83752470 missense possibly damaging 0.47
R8421:Atp6v1b1 UTSW 6 83753809 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCATAGTACGCCTGCTACG -3'
(R):5'- ACATGGGTTCAAGCCATAAAGG -3'

Sequencing Primer
(F):5'- ATAGTACGCCTGCTACGCCATC -3'
(R):5'- TTCAAGCCATAAAGGAGAAGGCTG -3'
Posted On2017-02-15