Incidental Mutation 'R5901:Vmn2r78'
ID 456323
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5901 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 86915300-86955177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86954588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 658 (V658A)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: V658A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: V658A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86920223 missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACCCTTGGGAATGGCTCTG -3'
(R):5'- AAGTTCCCAGCCAGATTCC -3'

Sequencing Primer
(F):5'- ATACTCTGTGTCTTCTTGAAACACCG -3'
(R):5'- GCCAGATTCCACAGAGAATCATTTG -3'
Posted On 2017-02-15