Incidental Mutation 'R5901:Faim'
ID456328
Institutional Source Beutler Lab
Gene Symbol Faim
Ensembl Gene ENSMUSG00000032463
Gene NameFas apoptotic inhibitory molecule
SynonymsFaim-L, Faim-S
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location98986373-99002021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98992142 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000108532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035038] [ENSMUST00000112911] [ENSMUST00000185472]
Predicted Effect probably benign
Transcript: ENSMUST00000035038
AA Change: V7A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035038
Gene: ENSMUSG00000032463
AA Change: V7A

DomainStartEndE-ValueType
Pfam:FAIM1 1 177 3e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112911
AA Change: V29A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108532
Gene: ENSMUSG00000032463
AA Change: V29A

DomainStartEndE-ValueType
Pfam:FAIM1 25 197 9.8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185472
AA Change: V7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140627
Gene: ENSMUSG00000032463
AA Change: V7A

DomainStartEndE-ValueType
Pfam:FAIM1 1 175 1.8e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene protects against death receptor-triggered apoptosis and regulates B-cell signaling and differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele have thymocytes with an enhanced susceptibility to FAS-induced apoptosis, and B cells that more susceptible to activation induced cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Faim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Faim APN 9 98992165 missense probably damaging 1.00
IGL00783:Faim APN 9 98992165 missense probably damaging 1.00
IGL00784:Faim APN 9 98992165 missense probably damaging 1.00
IGL00785:Faim APN 9 98992165 missense probably damaging 1.00
IGL00786:Faim APN 9 98992165 missense probably damaging 1.00
IGL00809:Faim APN 9 98992165 missense probably damaging 1.00
IGL00811:Faim APN 9 98992165 missense probably damaging 1.00
IGL00813:Faim APN 9 98992165 missense probably damaging 1.00
IGL00814:Faim APN 9 98992165 missense probably damaging 1.00
IGL00815:Faim APN 9 98992165 missense probably damaging 1.00
IGL00816:Faim APN 9 98992165 missense probably damaging 1.00
IGL00817:Faim APN 9 98992165 missense probably damaging 1.00
IGL00821:Faim APN 9 98992165 missense probably damaging 1.00
IGL01330:Faim APN 9 98992535 missense probably damaging 1.00
IGL01925:Faim APN 9 98990919 unclassified probably benign
IGL02703:Faim APN 9 98992201 missense probably benign 0.09
R0638:Faim UTSW 9 98992096 splice site probably benign
R1251:Faim UTSW 9 98992634 missense probably damaging 0.99
R5476:Faim UTSW 9 98992729 missense probably damaging 1.00
R6250:Faim UTSW 9 98992123 start codon destroyed probably benign 0.15
R7282:Faim UTSW 9 98992126 missense probably benign
R8034:Faim UTSW 9 98992733 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGGTATTGTCATGCTGG -3'
(R):5'- AGGTTTCCCAGGGTAGTCATTC -3'

Sequencing Primer
(F):5'- GCTGGAAGGGTTAATTAATCAGTCTC -3'
(R):5'- CCCAGGGTAGTCATTCTAAGTTTAG -3'
Posted On2017-02-15