Incidental Mutation 'R0557:Mki67'
ID45633
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 038749-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R0557 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135699261 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1348 (S1348N)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033310
AA Change: S1348N

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: S1348N

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Ano3 A T 2: 110,862,952 probably null Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chchd6 A G 6: 89,574,587 S31P probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Olfr350 T A 2: 36,850,748 I234N possibly damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Ppm1l A G 3: 69,497,901 D177G probably benign Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Wnt5b G T 6: 119,433,818 H220Q probably damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
R7422:Mki67 UTSW 7 135698370 missense probably damaging 1.00
R7451:Mki67 UTSW 7 135699351 missense probably benign 0.01
R7502:Mki67 UTSW 7 135700783 missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135693223 missense probably benign
R7578:Mki67 UTSW 7 135700915 missense possibly damaging 0.68
R7619:Mki67 UTSW 7 135699377 missense probably benign 0.01
R7646:Mki67 UTSW 7 135696769 missense possibly damaging 0.63
R7659:Mki67 UTSW 7 135697426 missense probably damaging 1.00
R7691:Mki67 UTSW 7 135701992 missense not run
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGCATCCTCTTGCTGTTAGGCATAC -3'
(R):5'- GGCACCACAGCCATTATGGAAACTC -3'

Sequencing Primer
(F):5'- GGTTTTGACAACCACTAATGGGC -3'
(R):5'- TTATGGAAACTCCAAAGCAGAAACTG -3'
Posted On2013-06-11