Incidental Mutation 'R5901:2300003K06Rik'
ID456337
Institutional Source Beutler Lab
Gene Symbol 2300003K06Rik
Ensembl Gene ENSMUSG00000078257
Gene NameRIKEN cDNA 2300003K06 gene
Synonyms
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99836802-99838066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99837337 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 227 (S227C)
Ref Sequence ENSEMBL: ENSMUSP00000100675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105054]
Predicted Effect unknown
Transcript: ENSMUST00000105054
AA Change: S227C
SMART Domains Protein: ENSMUSP00000100675
Gene: ENSMUSG00000078257
AA Change: S227C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 1.5e-9 PFAM
Pfam:Keratin_B2_2 34 78 1.9e-9 PFAM
Pfam:Keratin_B2_2 61 116 1.3e-4 PFAM
Pfam:Keratin_B2_2 99 142 4.2e-6 PFAM
Pfam:Keratin_B2_2 114 162 1.1e-5 PFAM
Pfam:Keratin_B2_2 158 202 4.4e-12 PFAM
Pfam:Keratin_B2_2 188 236 1.6e-9 PFAM
Pfam:Keratin_B2_2 231 262 6.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in 2300003K06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:2300003K06Rik APN 11 99837628 nonsense probably null
IGL02900:2300003K06Rik APN 11 99837948 missense possibly damaging 0.60
IGL03148:2300003K06Rik APN 11 99837253 missense unknown
R1445:2300003K06Rik UTSW 11 99837967 missense probably benign 0.03
R2054:2300003K06Rik UTSW 11 99837736 missense possibly damaging 0.71
R2273:2300003K06Rik UTSW 11 99837841 missense possibly damaging 0.93
R2274:2300003K06Rik UTSW 11 99837841 missense possibly damaging 0.93
R2275:2300003K06Rik UTSW 11 99837841 missense possibly damaging 0.93
R5153:2300003K06Rik UTSW 11 99837247 missense unknown
R6218:2300003K06Rik UTSW 11 99837904 missense probably benign 0.28
R6224:2300003K06Rik UTSW 11 99838014 start codon destroyed probably null 0.09
Predicted Primers PCR Primer
(F):5'- TGATCCAGGCCAAGACACTC -3'
(R):5'- GTTGCCAATCCACCTGCTAC -3'

Sequencing Primer
(F):5'- CAAGAACCACCAGAGCAGCTG -3'
(R):5'- CAGCTGCTGTGCTTCCAG -3'
Posted On2017-02-15