Incidental Mutation 'R5901:Ly6k'
ID456344
Institutional Source Beutler Lab
Gene Symbol Ly6k
Ensembl Gene ENSMUSG00000044678
Gene Namelymphocyte antigen 6 complex, locus K
Synonyms2410015A16Rik, 3110035B01Rik, mLy-6K
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74796874-74799986 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74798580 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 38 (S38T)
Ref Sequence ENSEMBL: ENSMUSP00000132129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060301] [ENSMUST00000168815]
Predicted Effect probably benign
Transcript: ENSMUST00000060301
AA Change: S38T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052599
Gene: ENSMUSG00000044678
AA Change: S38T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 21 117 2.54e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163707
Predicted Effect probably benign
Transcript: ENSMUST00000168815
AA Change: S38T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132129
Gene: ENSMUSG00000044678
AA Change: S38T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 21 117 2.54e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired sperm migration into the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Ly6k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02449:Ly6k APN 15 74797085 missense probably benign 0.00
R1926:Ly6k UTSW 15 74797202 missense probably benign 0.00
R2238:Ly6k UTSW 15 74797169 missense probably benign 0.00
R6963:Ly6k UTSW 15 74798582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGCATTCCTCTCATGTG -3'
(R):5'- TCCAGATGTGAAACACTGTCC -3'

Sequencing Primer
(F):5'- CTCATTATAGATGGTTGTGAGCCACC -3'
(R):5'- CAGATGTGAAACACTGTCCAAAAATG -3'
Posted On2017-02-15