Mutagenetix > Incidental Mutations

Incidental Mutation 'R5901:Dopey2'

456347

Institutional Source

Beutler Lab

Gene Symbol

Dopey2

Ensembl Gene

ENSMUSG00000022946

Gene Name

dopey family member 2

Synonyms

0610038M01Rik, 2610510B01Rik

MMRRC Submission

043239-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5901 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93711904-93810590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93769751 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1022 (E1022G)

Ref Sequence

ENSEMBL: ENSMUSP00000154771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045004
AA Change: E1140G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: E1140G

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	308	3.9e-104	PFAM
low complexity region	651	666	N/A	INTRINSIC
low complexity region	709	719	N/A	INTRINSIC
low complexity region	747	759	N/A	INTRINSIC
low complexity region	1186	1199	N/A	INTRINSIC
low complexity region	1436	1451	N/A	INTRINSIC
low complexity region	1893	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226215
AA Change: E350G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226535

Predicted Effect

probably benign
Transcript: ENSMUST00000226836
AA Change: E302G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227156
AA Change: E1022G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	T	A	11: 99,837,337	S227C	unknown	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adamts15	C	T	9: 30,902,490	R793H	probably damaging	Het
Ankra2	A	G	13: 98,271,136	E38G	probably damaging	Het
Aqp8	G	A	7: 123,462,584	C8Y	probably damaging	Het
Atg9b	A	G	5: 24,392,019		probably benign	Het
Atp6v1b1	A	G	6: 83,758,357	E469G	possibly damaging	Het
B4gat1	T	A	19: 5,039,213	Y79*	probably null	Het
BB019430	T	A	10: 58,704,192		noncoding transcript	Het
Calhm3	T	C	19: 47,157,613	Y51C	probably damaging	Het
Ccr2	C	T	9: 124,106,202	T173I	possibly damaging	Het
Cfap43	T	C	19: 47,897,099	D359G	probably damaging	Het
Drd2	T	A	9: 49,406,959	C400*	probably null	Het
Efcab7	T	A	4: 99,909,744	H495Q	probably damaging	Het
Faim	T	C	9: 98,992,142	V29A	probably benign	Het
Fancd2	T	C	6: 113,549,365	S350P	probably damaging	Het
Fbxw16	T	C	9: 109,441,217	E152G	probably benign	Het
Kif17	T	C	4: 138,298,332		probably null	Het
Kif24	A	T	4: 41,428,604	S119T	probably damaging	Het
Ly6k	A	T	15: 74,798,580	S38T	probably benign	Het
Mapk10	A	G	5: 102,913,292	S430P	probably damaging	Het
Megf10	G	A	18: 57,277,108	A654T	probably benign	Het
Mlph	T	C	1: 90,939,814	L450P	probably damaging	Het
Otof	T	C	5: 30,374,979	D1603G	probably damaging	Het
Pdcd11	T	C	19: 47,128,332	S1580P	possibly damaging	Het
Rad54b	G	A	4: 11,595,919	R232H	possibly damaging	Het
Sar1b	C	T	11: 51,779,749	T40I	possibly damaging	Het
Scyl2	C	T	10: 89,660,262	S242N	probably benign	Het
Sema4b	A	G	7: 80,224,967	N702D	possibly damaging	Het
Slc16a11	A	G	11: 70,216,346	I394V	probably benign	Het
Stard9	A	C	2: 120,701,370	T2703P	probably damaging	Het
Stat5b	A	T	11: 100,804,907	L83Q	possibly damaging	Het
Tas2r119	T	A	15: 32,177,786	V166D	possibly damaging	Het
Tmem117	T	A	15: 94,714,958	I125N	probably benign	Het
Tmem39a	T	C	16: 38,573,206	I89T	probably benign	Het
Ubr4	T	A	4: 139,451,254	H3272Q	probably damaging	Het
Vmn1r7	T	C	6: 57,024,606	E223G	probably damaging	Het
Vmn2r78	T	C	7: 86,954,588	V658A	probably damaging	Het
Xirp2	A	T	2: 67,513,066	T1884S	possibly damaging	Het
Xkr4	A	T	1: 3,216,678	F430I	probably damaging	Het
Yae1d1	A	G	13: 17,989,615	M1T	probably null	Het
Zfand4	T	C	6: 116,288,123	V183A	probably damaging	Het

Other mutations in Dopey2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Dopey2	APN	16	93800026	unclassified	probably benign
IGL00492:Dopey2	APN	16	93780782	missense	probably benign	0.00
IGL00753:Dopey2	APN	16	93769624	missense	probably benign
IGL00832:Dopey2	APN	16	93763401	missense	probably benign	0.01
IGL00939:Dopey2	APN	16	93774083	missense	possibly damaging	0.83
IGL01019:Dopey2	APN	16	93810229	missense	probably benign	0.32
IGL01288:Dopey2	APN	16	93739293	missense	possibly damaging	0.78
IGL01505:Dopey2	APN	16	93757116	missense	possibly damaging	0.87
IGL01535:Dopey2	APN	16	93769958	nonsense	probably null
IGL01696:Dopey2	APN	16	93770240	missense	probably benign	0.00
IGL02077:Dopey2	APN	16	93780760	missense	probably damaging	0.96
IGL02163:Dopey2	APN	16	93762427	missense	possibly damaging	0.48
IGL02234:Dopey2	APN	16	93752151	missense	probably benign
IGL02302:Dopey2	APN	16	93810117	missense	probably benign	0.08
IGL02485:Dopey2	APN	16	93770822	missense	probably damaging	1.00
IGL02563:Dopey2	APN	16	93777405	missense	probably damaging	0.99
IGL02733:Dopey2	APN	16	93739191	missense	possibly damaging	0.80
IGL02792:Dopey2	APN	16	93801572	missense	possibly damaging	0.75
IGL02941:Dopey2	APN	16	93755473	missense	probably benign	0.09
IGL03143:Dopey2	APN	16	93759655	missense	probably benign
PIT4519001:Dopey2	UTSW	16	93762054	missense	probably benign
R0320:Dopey2	UTSW	16	93810147	missense	probably benign	0.02
R0499:Dopey2	UTSW	16	93770437	missense	probably benign	0.00
R0501:Dopey2	UTSW	16	93752862	missense	probably benign	0.00
R0534:Dopey2	UTSW	16	93762505	missense	probably benign	0.04
R0583:Dopey2	UTSW	16	93755486	missense	probably benign	0.30
R0626:Dopey2	UTSW	16	93763956	missense	probably damaging	1.00
R0724:Dopey2	UTSW	16	93762325	missense	probably benign	0.01
R0907:Dopey2	UTSW	16	93801593	missense	probably damaging	1.00
R1263:Dopey2	UTSW	16	93777386	missense	probably benign
R1378:Dopey2	UTSW	16	93770392	missense	probably benign
R1572:Dopey2	UTSW	16	93770153	missense	probably damaging	1.00
R1604:Dopey2	UTSW	16	93762570	missense	probably benign
R1642:Dopey2	UTSW	16	93762315	missense	probably benign	0.00
R1668:Dopey2	UTSW	16	93765516	missense	probably damaging	1.00
R1669:Dopey2	UTSW	16	93769660	missense	probably damaging	1.00
R1702:Dopey2	UTSW	16	93747621	missense	possibly damaging	0.47
R1711:Dopey2	UTSW	16	93799926	missense	probably damaging	1.00
R1917:Dopey2	UTSW	16	93716262	missense	probably damaging	1.00
R1968:Dopey2	UTSW	16	93782419	missense	probably damaging	1.00
R1988:Dopey2	UTSW	16	93766173	missense	probably damaging	1.00
R2029:Dopey2	UTSW	16	93769435	missense	probably benign	0.36
R2139:Dopey2	UTSW	16	93771007	missense	possibly damaging	0.78
R2355:Dopey2	UTSW	16	93770677	missense	probably damaging	1.00
R3609:Dopey2	UTSW	16	93739332	missense	probably damaging	1.00
R3792:Dopey2	UTSW	16	93771846	missense	possibly damaging	0.54
R4364:Dopey2	UTSW	16	93770924	missense	probably benign	0.00
R4380:Dopey2	UTSW	16	93716232	missense	possibly damaging	0.53
R4455:Dopey2	UTSW	16	93766215	missense	probably damaging	1.00
R4779:Dopey2	UTSW	16	93757081	missense	probably damaging	1.00
R4820:Dopey2	UTSW	16	93793090	missense	probably benign	0.00
R4834:Dopey2	UTSW	16	93740004	start codon destroyed	probably null	0.70
R4866:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R4882:Dopey2	UTSW	16	93752914	missense	possibly damaging	0.95
R4900:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R5153:Dopey2	UTSW	16	93774003	missense	probably damaging	0.98
R5176:Dopey2	UTSW	16	93740043	missense	probably damaging	1.00
R5206:Dopey2	UTSW	16	93801584	missense	probably damaging	1.00
R5320:Dopey2	UTSW	16	93739986	missense	probably damaging	1.00
R5361:Dopey2	UTSW	16	93770504	missense	probably damaging	1.00
R5380:Dopey2	UTSW	16	93763410	missense	probably damaging	0.96
R5476:Dopey2	UTSW	16	93773913	splice site	probably null
R5502:Dopey2	UTSW	16	93793226	missense	probably benign	0.00
R5543:Dopey2	UTSW	16	93798920	missense	probably damaging	0.98
R5557:Dopey2	UTSW	16	93763931	missense	probably damaging	0.96
R5907:Dopey2	UTSW	16	93801581	missense	probably damaging	1.00
R6174:Dopey2	UTSW	16	93766222	missense	probably damaging	1.00
R6256:Dopey2	UTSW	16	93807214	missense	possibly damaging	0.94
R6383:Dopey2	UTSW	16	93782248	missense	possibly damaging	0.76
R6525:Dopey2	UTSW	16	93809416	missense	probably damaging	1.00
R6554:Dopey2	UTSW	16	93760458	missense	probably benign	0.22
R6823:Dopey2	UTSW	16	93755485	missense	possibly damaging	0.75
R7036:Dopey2	UTSW	16	93777490	missense	probably benign	0.01
R7058:Dopey2	UTSW	16	93776990	missense	probably benign	0.00
R7061:Dopey2	UTSW	16	93762063	missense	probably benign	0.00
R7209:Dopey2	UTSW	16	93769845	missense	probably benign
R7214:Dopey2	UTSW	16	93810135	missense	possibly damaging	0.69
R7232:Dopey2	UTSW	16	93760485	critical splice donor site	probably null
R7255:Dopey2	UTSW	16	93770146	missense	probably damaging	1.00
R7335:Dopey2	UTSW	16	93747508	missense	probably benign	0.04
R7535:Dopey2	UTSW	16	93806361	missense	probably damaging	1.00
R7700:Dopey2	UTSW	16	93798761	splice site	probably null
R7763:Dopey2	UTSW	16	93755514	missense	probably benign	0.00
R7814:Dopey2	UTSW	16	93799971	missense	probably damaging	1.00
R7839:Dopey2	UTSW	16	93763941	missense	probably damaging	1.00
R7862:Dopey2	UTSW	16	93749963	missense	probably damaging	1.00
R7894:Dopey2	UTSW	16	93810204	missense	probably benign	0.01
R7952:Dopey2	UTSW	16	93749960	missense	possibly damaging	0.93
R7956:Dopey2	UTSW	16	93771028	critical splice donor site	probably null
R8033:Dopey2	UTSW	16	93769483	missense	probably benign
R8061:Dopey2	UTSW	16	93749996	missense	probably damaging	1.00
R8067:Dopey2	UTSW	16	93765448	nonsense	probably null
R8146:Dopey2	UTSW	16	93749939	missense	possibly damaging	0.95
R8184:Dopey2	UTSW	16	93776993	missense	probably benign	0.13
R8221:Dopey2	UTSW	16	93749959	missense	probably benign	0.01
R8263:Dopey2	UTSW	16	93762195	missense	possibly damaging	0.87
R8329:Dopey2	UTSW	16	93771787	missense	probably damaging	1.00
Z1088:Dopey2	UTSW	16	93763326	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93769581	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93803546	missense	probably damaging	1.00
Z1176:Dopey2	UTSW	16	93807868	missense	possibly damaging	0.82
Z1177:Dopey2	UTSW	16	93763895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCCACCAAGAAGTGATCTAAG -3'
(R):5'- ACAGCCTCGATGTGGTGATG -3'

Sequencing Primer
(F):5'- CCCACCAAGAAGTGATCTAAGTGAGG -3'
(R):5'- TGGAGCTCCACGTCAGC -3'

Posted On

2017-02-15