Incidental Mutation 'R5901:Dopey2'
ID456347
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93769751 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1022 (E1022G)
Ref Sequence ENSEMBL: ENSMUSP00000154771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045004
AA Change: E1140G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: E1140G

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226215
AA Change: E350G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226535
Predicted Effect probably benign
Transcript: ENSMUST00000226836
AA Change: E302G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227156
AA Change: E1022G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Calhm3 T C 19: 47,157,613 Y51C probably damaging Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7700:Dopey2 UTSW 16 93798761 splice site probably null
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7952:Dopey2 UTSW 16 93749960 missense possibly damaging 0.93
R7956:Dopey2 UTSW 16 93771028 critical splice donor site probably null
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
R8146:Dopey2 UTSW 16 93749939 missense possibly damaging 0.95
R8184:Dopey2 UTSW 16 93776993 missense probably benign 0.13
R8221:Dopey2 UTSW 16 93749959 missense probably benign 0.01
R8263:Dopey2 UTSW 16 93762195 missense possibly damaging 0.87
R8329:Dopey2 UTSW 16 93771787 missense probably damaging 1.00
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCACCAAGAAGTGATCTAAG -3'
(R):5'- ACAGCCTCGATGTGGTGATG -3'

Sequencing Primer
(F):5'- CCCACCAAGAAGTGATCTAAGTGAGG -3'
(R):5'- TGGAGCTCCACGTCAGC -3'
Posted On2017-02-15