Incidental Mutation 'R5901:Calhm3'
ID456351
Institutional Source Beutler Lab
Gene Symbol Calhm3
Ensembl Gene ENSMUSG00000094219
Gene Namecalcium homeostasis modulator 3
Synonyms
MMRRC Submission 043239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5901 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47151609-47157764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47157613 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 51 (Y51C)
Ref Sequence ENSEMBL: ENSMUSP00000136302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178630]
Predicted Effect probably damaging
Transcript: ENSMUST00000178630
AA Change: Y51C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136302
Gene: ENSMUSG00000094219
AA Change: Y51C

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 252 1.9e-103 PFAM
low complexity region 268 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik T A 11: 99,837,337 S227C unknown Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts15 C T 9: 30,902,490 R793H probably damaging Het
Ankra2 A G 13: 98,271,136 E38G probably damaging Het
Aqp8 G A 7: 123,462,584 C8Y probably damaging Het
Atg9b A G 5: 24,392,019 probably benign Het
Atp6v1b1 A G 6: 83,758,357 E469G possibly damaging Het
B4gat1 T A 19: 5,039,213 Y79* probably null Het
BB019430 T A 10: 58,704,192 noncoding transcript Het
Ccr2 C T 9: 124,106,202 T173I possibly damaging Het
Cfap43 T C 19: 47,897,099 D359G probably damaging Het
Dopey2 A G 16: 93,769,751 E1022G possibly damaging Het
Drd2 T A 9: 49,406,959 C400* probably null Het
Efcab7 T A 4: 99,909,744 H495Q probably damaging Het
Faim T C 9: 98,992,142 V29A probably benign Het
Fancd2 T C 6: 113,549,365 S350P probably damaging Het
Fbxw16 T C 9: 109,441,217 E152G probably benign Het
Kif17 T C 4: 138,298,332 probably null Het
Kif24 A T 4: 41,428,604 S119T probably damaging Het
Ly6k A T 15: 74,798,580 S38T probably benign Het
Mapk10 A G 5: 102,913,292 S430P probably damaging Het
Megf10 G A 18: 57,277,108 A654T probably benign Het
Mlph T C 1: 90,939,814 L450P probably damaging Het
Otof T C 5: 30,374,979 D1603G probably damaging Het
Pdcd11 T C 19: 47,128,332 S1580P possibly damaging Het
Rad54b G A 4: 11,595,919 R232H possibly damaging Het
Sar1b C T 11: 51,779,749 T40I possibly damaging Het
Scyl2 C T 10: 89,660,262 S242N probably benign Het
Sema4b A G 7: 80,224,967 N702D possibly damaging Het
Slc16a11 A G 11: 70,216,346 I394V probably benign Het
Stard9 A C 2: 120,701,370 T2703P probably damaging Het
Stat5b A T 11: 100,804,907 L83Q possibly damaging Het
Tas2r119 T A 15: 32,177,786 V166D possibly damaging Het
Tmem117 T A 15: 94,714,958 I125N probably benign Het
Tmem39a T C 16: 38,573,206 I89T probably benign Het
Ubr4 T A 4: 139,451,254 H3272Q probably damaging Het
Vmn1r7 T C 6: 57,024,606 E223G probably damaging Het
Vmn2r78 T C 7: 86,954,588 V658A probably damaging Het
Xirp2 A T 2: 67,513,066 T1884S possibly damaging Het
Xkr4 A T 1: 3,216,678 F430I probably damaging Het
Yae1d1 A G 13: 17,989,615 M1T probably null Het
Zfand4 T C 6: 116,288,123 V183A probably damaging Het
Other mutations in Calhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Calhm3 UTSW 19 47151896 frame shift probably null
R1203:Calhm3 UTSW 19 47155400 missense probably damaging 1.00
R1863:Calhm3 UTSW 19 47152100 missense probably damaging 1.00
R1911:Calhm3 UTSW 19 47155469 missense possibly damaging 0.74
R1951:Calhm3 UTSW 19 47151817 missense probably benign 0.00
R2089:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2091:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2273:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2274:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2436:Calhm3 UTSW 19 47151965 missense probably damaging 1.00
R3702:Calhm3 UTSW 19 47151748 missense possibly damaging 0.88
R5758:Calhm3 UTSW 19 47151751 missense probably damaging 0.99
R5938:Calhm3 UTSW 19 47152077 missense probably damaging 1.00
R6948:Calhm3 UTSW 19 47151905 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGAACATCTTTAGCTGTCAG -3'
(R):5'- TCCACGTGGCTACAGTCATG -3'

Sequencing Primer
(F):5'- GCCAGGAAGACTATATCTGATGTC -3'
(R):5'- CCACGTGGCTACAGTCATGGATAG -3'
Posted On2017-02-15