Mutagenetix > Incidental Mutation

Incidental Mutation 'R5902:Zdbf2'

456354

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

044100-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R5902 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63306526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1355 (S1355P)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: S1355P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1355P

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: S1355P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1355P

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.4%
20x: 92.1%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	G	2: 68,708,937	M1V	probably null	Het
Abca13	T	A	11: 9,297,177	L2308H	probably damaging	Het
Abcc8	T	C	7: 46,115,039	T1161A	probably benign	Het
Acin1	T	A	14: 54,663,673	T659S	probably benign	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Alkbh8	A	G	9: 3,385,414	K569E	probably benign	Het
Anxa3	A	T	5: 96,812,853	K39*	probably null	Het
Aoc2	A	G	11: 101,329,246	E659G	probably damaging	Het
Atg7	C	T	6: 114,673,678	T83M	possibly damaging	Het
AU022252	T	C	4: 119,226,904	D104G	probably benign	Het
Car6	T	C	4: 150,187,499	Y231C	possibly damaging	Het
Ccdc94	A	G	17: 55,962,077	T62A	probably damaging	Het
Cdh10	T	G	15: 18,985,255		probably null	Het
Cebpz	A	C	17: 78,925,937	M787R	probably benign	Het
Chst2	A	G	9: 95,405,609	L228P	probably damaging	Het
Clic4	T	C	4: 135,272,558	K11R	probably benign	Het
Col6a3	C	T	1: 90,802,199		probably null	Het
Commd7	T	A	2: 153,621,817	T144S	probably damaging	Het
Ctla2a	T	A	13: 60,935,020	*138Y	probably null	Het
Dhx33	A	T	11: 70,989,131	V351D	probably damaging	Het
Dnah9	G	A	11: 66,025,187	T2313I	probably benign	Het
Dspp	A	T	5: 104,178,111	D780V	unknown	Het
Dync1li1	A	G	9: 114,717,861		probably null	Het
E2f3	C	T	13: 29,985,267		probably benign	Het
Fan1	T	C	7: 64,373,322		probably null	Het
Gart	A	G	16: 91,628,527	S617P	probably damaging	Het
Ggcx	A	G	6: 72,429,996	N705S	possibly damaging	Het
Gm4841	A	T	18: 60,270,796	V75E	probably damaging	Het
Greb1l	A	G	18: 10,538,302	E1105G	probably benign	Het
Hr	C	A	14: 70,557,791	Q288K	probably benign	Het
Hus1	T	C	11: 9,010,669		probably benign	Het
Ifi47	C	A	11: 49,095,386		probably null	Het
Irf2bp1	T	C	7: 19,004,447	V4A	probably benign	Het
Kprp	C	T	3: 92,824,528	C405Y	unknown	Het
Lacc1	T	C	14: 77,034,799	I186V	possibly damaging	Het
Lifr	A	G	15: 7,190,750	T954A	probably benign	Het
Lonrf2	T	C	1: 38,807,093	M333V	probably benign	Het
Mthfd1	A	T	12: 76,291,052	H400L	probably benign	Het
Myh4	A	G	11: 67,250,907	K864R	possibly damaging	Het
Nup50	C	T	15: 84,935,440	A305V	probably benign	Het
Olfr1247	T	A	2: 89,609,251	I284L	probably damaging	Het
Olfr1294	C	T	2: 111,537,394	M298I	probably benign	Het
Pax4	G	T	6: 28,447,127	Q3K	probably benign	Het
Pced1b	T	G	15: 97,385,089	Y336*	probably null	Het
Postn	C	A	3: 54,372,089	N329K	probably benign	Het
Prickle1	T	C	15: 93,510,672	E82G	probably null	Het
Prtn3	T	C	10: 79,882,932	Y241H	probably damaging	Het
Rasgrf2	A	T	13: 91,919,892	I260K	probably damaging	Het
Sh3glb1	T	C	3: 144,712,670	N44S	possibly damaging	Het
Sis	A	T	3: 72,960,256		probably null	Het
Slc4a9	A	G	18: 36,529,333		probably null	Het
Slc4a9	A	T	18: 36,531,507	D406V	probably damaging	Het
Slc8a1	C	T	17: 81,408,082	G841R	probably damaging	Het
Smn1	C	T	13: 100,126,904	P60L	probably benign	Het
Snai1	G	A	2: 167,542,010	C241Y	probably damaging	Het
Spock3	A	G	8: 63,355,302	D411G	unknown	Het
Szt2	T	A	4: 118,391,503	T607S	probably benign	Het
Tcap	A	T	11: 98,383,847	M1L	probably benign	Het
Tex29	C	A	8: 11,854,276		probably benign	Het
Tex29	C	T	8: 11,854,277		probably benign	Het
Tex29	A	T	8: 11,855,723		probably benign	Het
Tln2	T	C	9: 67,362,717	T467A	probably benign	Het
Trim34a	C	T	7: 104,261,121	Q377*	probably null	Het
Ube2q1	T	A	3: 89,776,180	L144*	probably null	Het
Vps13c	A	G	9: 67,934,447	E1917G	probably benign	Het
Wdr19	T	A	5: 65,227,139	N525K	probably benign	Het
Wdr3	A	T	3: 100,144,491		probably benign	Het
Wnt5b	T	A	6: 119,448,238	H6L	probably benign	Het
Zfp11	T	A	5: 129,657,912	I162F	probably damaging	Het
Zpbp	T	C	11: 11,415,332	T172A	probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CAGGACATTGACCATTGGAAGG -3'
(R):5'- TCCAGGTAAATATGGTCTTCCTTCAG -3'

Sequencing Primer
(F):5'- CCATTGGAAGGATCATGTTGAC -3'
(R):5'- CTTCAGATTCATTTCCTTGTCAGG -3'

Posted On

2017-02-15