Incidental Mutation 'R5902:Hus1'
ID456393
Institutional Source Beutler Lab
Gene Symbol Hus1
Ensembl Gene ENSMUSG00000020413
Gene NameHUS1 checkpoint clamp component
Synonyms
MMRRC Submission 044100-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5902 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location8993137-9011191 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 9010669 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000129115]
Predicted Effect probably benign
Transcript: ENSMUST00000020683
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127578
Predicted Effect probably benign
Transcript: ENSMUST00000129115
SMART Domains Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 4.8e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152890
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,708,937 M1V probably null Het
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dspp A T 5: 104,178,111 D780V unknown Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Irf2bp1 T C 7: 19,004,447 V4A probably benign Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Nup50 C T 15: 84,935,440 A305V probably benign Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Rasgrf2 A T 13: 91,919,892 I260K probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Sis A T 3: 72,960,256 probably null Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in Hus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hus1 APN 11 9000082 missense probably benign 0.00
IGL01974:Hus1 APN 11 9000088 missense possibly damaging 0.58
IGL02301:Hus1 APN 11 8996915 missense probably benign
IGL02436:Hus1 APN 11 9006057 missense possibly damaging 0.93
R0694:Hus1 UTSW 11 9007531 nonsense probably null
R2108:Hus1 UTSW 11 9011110 start codon destroyed probably null 1.00
R2128:Hus1 UTSW 11 9006011 missense probably damaging 1.00
R2329:Hus1 UTSW 11 9007492 critical splice donor site probably null
R4363:Hus1 UTSW 11 8998676 missense probably damaging 1.00
R4420:Hus1 UTSW 11 9000133 missense probably damaging 1.00
R4453:Hus1 UTSW 11 9006035 missense probably damaging 1.00
R4572:Hus1 UTSW 11 9007617 splice site probably null
R4818:Hus1 UTSW 11 8996808 utr 3 prime probably benign
R4913:Hus1 UTSW 11 8996856 missense probably benign 0.03
R4989:Hus1 UTSW 11 9006027 missense probably damaging 0.97
R5402:Hus1 UTSW 11 9010240 critical splice donor site probably null
R6402:Hus1 UTSW 11 9010407 missense probably damaging 1.00
R7792:Hus1 UTSW 11 9000133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAACAGGCATTTGTGGC -3'
(R):5'- TCTGTGGAATGTGGAACCG -3'

Sequencing Primer
(F):5'- TGGAGCCCAGAACCTCTG -3'
(R):5'- AATGTGGAACCGCCTGG -3'
Posted On2017-02-15