Incidental Mutation 'R5902:Nup50'
ID456412
Institutional Source Beutler Lab
Gene Symbol Nup50
Ensembl Gene ENSMUSG00000016619
Gene Namenucleoporin 50
Synonyms1700030K07Rik, Npap60
MMRRC Submission 044100-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5902 (G1)
Quality Score157
Status Validated
Chromosome15
Chromosomal Location84923411-84942963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84935440 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 305 (A305V)
Ref Sequence ENSEMBL: ENSMUSP00000155656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165443] [ENSMUST00000230411]
Predicted Effect probably benign
Transcript: ENSMUST00000165443
AA Change: A305V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131457
Gene: ENSMUSG00000016619
AA Change: A305V

DomainStartEndE-ValueType
Pfam:NUP50 2 80 1.2e-22 PFAM
low complexity region 277 302 N/A INTRINSIC
RanBD 340 463 4.83e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230411
AA Change: A305V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins that functions as a soluble cofactor in importin-alpha:beta-mediated nuclear protein import. Pseudogenes of this gene are found on chromosomes 5, 6, and 14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die perinatally, displaying neural tube defects, exencephaly, and intrauterine growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,708,937 M1V probably null Het
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dspp A T 5: 104,178,111 D780V unknown Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Hus1 T C 11: 9,010,669 probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Irf2bp1 T C 7: 19,004,447 V4A probably benign Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Rasgrf2 A T 13: 91,919,892 I260K probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Sis A T 3: 72,960,256 probably null Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in Nup50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Nup50 APN 15 84935404 missense probably benign 0.33
IGL00939:Nup50 APN 15 84938420 nonsense probably null
R1483:Nup50 UTSW 15 84939727 missense probably damaging 1.00
R1545:Nup50 UTSW 15 84939792 missense possibly damaging 0.51
R2504:Nup50 UTSW 15 84933658 missense probably benign 0.00
R3005:Nup50 UTSW 15 84929460 splice site probably null
R3690:Nup50 UTSW 15 84939793 missense probably damaging 1.00
R4851:Nup50 UTSW 15 84939711 missense probably benign 0.03
R7205:Nup50 UTSW 15 84933658 missense probably benign 0.00
R8350:Nup50 UTSW 15 84935275 missense probably benign 0.01
R8450:Nup50 UTSW 15 84935275 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTACAGCAAGAGTCACCATTTTC -3'
(R):5'- GAACTAAGGCACCGTGACAC -3'

Sequencing Primer
(F):5'- AGAGTCACCATTTTCATTTCATGGC -3'
(R):5'- CACACACAGGACAGGGAGC -3'
Posted On2017-02-15