Mutagenetix > Incidental Mutations

Incidental Mutation 'R5903:Gle1'

456426

Institutional Source

Beutler Lab

Gene Symbol

Gle1

Ensembl Gene

ENSMUSG00000019715

Gene Name

GLE1 RNA export mediator (yeast)

Synonyms

4933405K21Rik

MMRRC Submission

044101-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5903 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

29935426-29960371 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 29940281 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 283 (T283N)

Ref Sequence

ENSEMBL: ENSMUSP00000019859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019859]

Predicted Effect

probably benign
Transcript: ENSMUST00000019859
AA Change: T283N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715
AA Change: T283N

Domain	Start	End	E-Value	Type
low complexity region	67	88	N/A	INTRINSIC
low complexity region	91	105	N/A	INTRINSIC
coiled coil region	154	275	N/A	INTRINSIC
coiled coil region	306	356	N/A	INTRINSIC
Pfam:GLE1	397	650	2.4e-90	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123608

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148983

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154490

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Gle1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Gle1	APN	2	29939289	splice site	probably benign
IGL01880:Gle1	APN	2	29943750	missense	possibly damaging	0.53
IGL02293:Gle1	APN	2	29957760	missense	probably benign	0.00
IGL02859:Gle1	APN	2	29949228	missense	probably damaging	1.00
IGL03368:Gle1	APN	2	29943793	missense	probably damaging	1.00
R0535:Gle1	UTSW	2	29957805	missense	probably damaging	1.00
R0608:Gle1	UTSW	2	29940228	missense	probably benign	0.01
R0839:Gle1	UTSW	2	29958450	missense	probably benign	0.28
R0908:Gle1	UTSW	2	29936121	missense	probably benign	0.06
R1102:Gle1	UTSW	2	29944054	missense	possibly damaging	0.88
R1202:Gle1	UTSW	2	29949265	missense	probably damaging	1.00
R1302:Gle1	UTSW	2	29952552	splice site	probably null
R2184:Gle1	UTSW	2	29949018	missense	probably damaging	1.00
R2213:Gle1	UTSW	2	29949301	missense	probably damaging	0.97
R4151:Gle1	UTSW	2	29944044	missense	probably damaging	1.00
R4172:Gle1	UTSW	2	29938526	missense	probably benign
R4732:Gle1	UTSW	2	29940232	missense	probably damaging	0.96
R4733:Gle1	UTSW	2	29940232	missense	probably damaging	0.96
R4775:Gle1	UTSW	2	29936061	missense	possibly damaging	0.86
R4817:Gle1	UTSW	2	29936211	missense	probably benign	0.00
R4824:Gle1	UTSW	2	29940203	missense	possibly damaging	0.82
R4869:Gle1	UTSW	2	29936020	missense	possibly damaging	0.69
R4909:Gle1	UTSW	2	29936080	missense	probably benign	0.01
R5036:Gle1	UTSW	2	29936211	missense	probably benign	0.00
R5298:Gle1	UTSW	2	29948943	missense	probably benign	0.02
R6345:Gle1	UTSW	2	29936115	missense	probably benign	0.00
R6529:Gle1	UTSW	2	29935527	missense	possibly damaging	0.56
R7144:Gle1	UTSW	2	29943793	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTAAAGCTTCGAGAGGCAG -3'
(R):5'- CTCCAACAGGCAGGCATTAC -3'

Sequencing Primer
(F):5'- CTTCGAGAGGCAGAGCAGC -3'
(R):5'- GTCCAGGAACTCGTTCTGTAGAC -3'

Posted On

2017-02-15