Incidental Mutation 'R5903:P2rx3'
ID 456428
Institutional Source Beutler Lab
Gene Symbol P2rx3
Ensembl Gene ENSMUSG00000027071
Gene Name purinergic receptor P2X, ligand-gated ion channel, 3
Synonyms 4930513E20Rik, P2X3
MMRRC Submission 044101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5903 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 84998583-85037462 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85000727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 265 (E265G)
Ref Sequence ENSEMBL: ENSMUSP00000107243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000111613] [ENSMUST00000111616]
AlphaFold Q3UR32
Predicted Effect possibly damaging
Transcript: ENSMUST00000028465
AA Change: E289G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071
AA Change: E289G

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 367 1.6e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111613
AA Change: E287G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071
AA Change: E287G

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111616
AA Change: E265G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071
AA Change: E265G

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 91 1.2e-32 PFAM
Pfam:P2X_receptor 86 350 3.3e-113 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show normal ventilatory responses to hypoxia. Mice homozygous for a reporter allele show loss of rapidly desensitizing ATP-gated cation currents in dorsal root ganglion neurons, reduced formalin-evoked pain behavior, and enhanced thermal hyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in P2rx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:P2rx3 APN 2 85035272 missense probably damaging 1.00
IGL01775:P2rx3 APN 2 85024157 missense probably benign
IGL01897:P2rx3 APN 2 85023481 critical splice donor site probably benign
IGL02399:P2rx3 APN 2 85023227 missense probably benign
R0928:P2rx3 UTSW 2 85035298 start codon destroyed probably null 0.98
R1428:P2rx3 UTSW 2 85024950 missense possibly damaging 0.91
R1537:P2rx3 UTSW 2 85023481 critical splice donor site probably null
R1678:P2rx3 UTSW 2 85022467 missense possibly damaging 0.90
R4332:P2rx3 UTSW 2 85024861 missense probably benign 0.25
R4897:P2rx3 UTSW 2 85024926 missense probably damaging 1.00
R5052:P2rx3 UTSW 2 84999024 missense probably benign 0.01
R5917:P2rx3 UTSW 2 85035247 missense probably damaging 1.00
R6614:P2rx3 UTSW 2 85035199 missense probably damaging 1.00
R8250:P2rx3 UTSW 2 85022391 missense probably damaging 1.00
R8512:P2rx3 UTSW 2 85024411 missense probably damaging 0.98
R8953:P2rx3 UTSW 2 85023498 missense possibly damaging 0.61
R9237:P2rx3 UTSW 2 85023552 missense probably benign 0.02
Z1177:P2rx3 UTSW 2 85022476 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CCTACATAGTATAGGAAGCTGATGGG -3'
(R):5'- ACGACCCAGGAATCTGCTTG -3'

Sequencing Primer
(F):5'- CTGATGGGGGATATGGCCAG -3'
(R):5'- GTTAAAATCTCCATGGTATCGGTCC -3'
Posted On 2017-02-15