Incidental Mutation 'R5903:Slc9b1'
ID456430
Institutional Source Beutler Lab
Gene Symbol Slc9b1
Ensembl Gene ENSMUSG00000050150
Gene Namesolute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135348029-135397827 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 135392894 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000161417]
Predicted Effect probably benign
Transcript: ENSMUST00000078568
SMART Domains Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 148 542 4.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160460
SMART Domains Protein: ENSMUSP00000124902
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 149 363 1.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161417
SMART Domains Protein: ENSMUSP00000125203
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 2 75 1.1e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Slc9b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Slc9b1 APN 3 135371982 unclassified probably null
IGL02793:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02875:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02977:Slc9b1 APN 3 135397723 missense probably damaging 1.00
IGL02990:Slc9b1 APN 3 135394983 splice site probably null
IGL03112:Slc9b1 APN 3 135397672 missense probably damaging 1.00
IGL03277:Slc9b1 APN 3 135390508 missense possibly damaging 0.46
IGL03409:Slc9b1 APN 3 135394909 missense probably damaging 0.99
R0190:Slc9b1 UTSW 3 135357673 missense unknown
R0329:Slc9b1 UTSW 3 135373235 nonsense probably null
R0591:Slc9b1 UTSW 3 135382832 missense possibly damaging 0.88
R0592:Slc9b1 UTSW 3 135394074 splice site probably benign
R0602:Slc9b1 UTSW 3 135397755 missense probably benign 0.00
R0893:Slc9b1 UTSW 3 135394890 missense probably benign 0.15
R1250:Slc9b1 UTSW 3 135348770 start codon destroyed probably null
R1619:Slc9b1 UTSW 3 135355004 splice site probably null
R1840:Slc9b1 UTSW 3 135357468 missense unknown
R3157:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R3159:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R4565:Slc9b1 UTSW 3 135382717 missense probably damaging 1.00
R5138:Slc9b1 UTSW 3 135357773 intron probably benign
R5154:Slc9b1 UTSW 3 135373179 missense probably damaging 1.00
R5429:Slc9b1 UTSW 3 135373263 critical splice donor site probably null
R5677:Slc9b1 UTSW 3 135357559 missense unknown
R5933:Slc9b1 UTSW 3 135393995 missense probably benign 0.30
R6593:Slc9b1 UTSW 3 135357458 start codon destroyed probably null
R6667:Slc9b1 UTSW 3 135371965 missense probably damaging 0.99
R6788:Slc9b1 UTSW 3 135357757 splice site probably null
RF006:Slc9b1 UTSW 3 135357542 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGTTACGTCAGCTAACGGGG -3'
(R):5'- CCCAAGTGATAATTTGCAGTATCG -3'

Sequencing Primer
(F):5'- CTAACGGGGGAATCTTCACTCTG -3'
(R):5'- GGAGTCCATTCCTACACAATACTTG -3'
Posted On2017-02-15