Mutagenetix > Incidental Mutations

Incidental Mutation 'R5903:Slc9b1'

456430

Institutional Source

Beutler Lab

Gene Symbol

Slc9b1

Ensembl Gene

ENSMUSG00000050150

Gene Name

solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1

Synonyms

MMRRC Submission

044101-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135348029-135397827 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 135392894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000161417]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000078568

SMART Domains

Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150

Domain	Start	End	E-Value	Type
low complexity region	32	105	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:Na_H_Exchanger	148	542	4.7e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160460

SMART Domains

Protein: ENSMUSP00000124902
Gene: ENSMUSG00000050150

Domain	Start	End	E-Value	Type
low complexity region	32	105	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:Na_H_Exchanger	149	363	1.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161417

SMART Domains

Protein: ENSMUSP00000125203
Gene: ENSMUSG00000050150

Domain	Start	End	E-Value	Type
Pfam:Na_H_Exchanger	2	75	1.1e-7	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Slc9b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01979:Slc9b1	APN	3	135371982	splice site	probably null
IGL02793:Slc9b1	APN	3	135374406	unclassified	probably benign
IGL02875:Slc9b1	APN	3	135374406	unclassified	probably benign
IGL02977:Slc9b1	APN	3	135397723	missense	probably damaging	1.00
IGL02990:Slc9b1	APN	3	135394983	splice site	probably null
IGL03112:Slc9b1	APN	3	135397672	missense	probably damaging	1.00
IGL03277:Slc9b1	APN	3	135390508	missense	possibly damaging	0.46
IGL03409:Slc9b1	APN	3	135394909	missense	probably damaging	0.99
R0190:Slc9b1	UTSW	3	135357673	missense	unknown
R0329:Slc9b1	UTSW	3	135373235	nonsense	probably null
R0591:Slc9b1	UTSW	3	135382832	missense	possibly damaging	0.88
R0592:Slc9b1	UTSW	3	135394074	splice site	probably benign
R0602:Slc9b1	UTSW	3	135397755	missense	probably benign	0.00
R0893:Slc9b1	UTSW	3	135394890	missense	probably benign	0.15
R1250:Slc9b1	UTSW	3	135348770	start codon destroyed	probably null
R1619:Slc9b1	UTSW	3	135355004	splice site	probably null
R1840:Slc9b1	UTSW	3	135357468	missense	unknown
R3157:Slc9b1	UTSW	3	135371845	missense	probably damaging	1.00
R3159:Slc9b1	UTSW	3	135371845	missense	probably damaging	1.00
R4565:Slc9b1	UTSW	3	135382717	missense	probably damaging	1.00
R5138:Slc9b1	UTSW	3	135357773	intron	probably benign
R5154:Slc9b1	UTSW	3	135373179	missense	probably damaging	1.00
R5429:Slc9b1	UTSW	3	135373263	critical splice donor site	probably null
R5677:Slc9b1	UTSW	3	135357559	missense	unknown
R5933:Slc9b1	UTSW	3	135393995	missense	probably benign	0.30
R6593:Slc9b1	UTSW	3	135357458	start codon destroyed	probably null
R6667:Slc9b1	UTSW	3	135371965	missense	probably damaging	0.99
R6788:Slc9b1	UTSW	3	135357757	splice site	probably null
R7974:Slc9b1	UTSW	3	135394030	missense	possibly damaging	0.57
R8210:Slc9b1	UTSW	3	135392187	missense	probably damaging	1.00
R8276:Slc9b1	UTSW	3	135371897	missense	possibly damaging	0.63
R8988:Slc9b1	UTSW	3	135373139	missense	possibly damaging	0.69
R9102:Slc9b1	UTSW	3	135394964	missense	probably damaging	1.00
R9266:Slc9b1	UTSW	3	135348707	intron	probably benign
RF006:Slc9b1	UTSW	3	135357542	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTTACGTCAGCTAACGGGG -3'
(R):5'- CCCAAGTGATAATTTGCAGTATCG -3'

Sequencing Primer
(F):5'- CTAACGGGGGAATCTTCACTCTG -3'
(R):5'- GGAGTCCATTCCTACACAATACTTG -3'

Posted On

2017-02-15