Incidental Mutation 'R5903:Actl7a'
ID456432
Institutional Source Beutler Lab
Gene Symbol Actl7a
Ensembl Gene ENSMUSG00000070979
Gene Nameactin-like 7a
SynonymsTact2, t-actin 2
MMRRC Submission 044101-MU
Accession Numbers

Ncbi RefSeq: NM_009611.3; MGI:1343051

Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56743413-56744925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56743827 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 118 (R118L)
Ref Sequence ENSEMBL: ENSMUSP00000092692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably damaging
Transcript: ENSMUST00000095079
AA Change: R118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979
AA Change: R118L

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7A), and related gene, ACTL7B, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7A gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. The ACTL7A gene is expressed in a wide variety of adult tissues, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Actl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Actl7a APN 4 56743944 missense possibly damaging 0.86
IGL01767:Actl7a APN 4 56743980 missense probably damaging 1.00
IGL02626:Actl7a APN 4 56744353 missense possibly damaging 0.89
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R1741:Actl7a UTSW 4 56744252 missense probably benign 0.03
R1920:Actl7a UTSW 4 56744135 missense probably damaging 1.00
R2984:Actl7a UTSW 4 56744531 missense probably benign 0.00
R3716:Actl7a UTSW 4 56744295 missense possibly damaging 0.67
R4779:Actl7a UTSW 4 56743632 missense probably benign 0.07
R5391:Actl7a UTSW 4 56743661 missense probably benign
R5540:Actl7a UTSW 4 56744388 missense probably benign 0.00
R5723:Actl7a UTSW 4 56744310 missense probably damaging 0.99
R5902:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5922:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R6010:Actl7a UTSW 4 56743870 missense possibly damaging 0.50
R6786:Actl7a UTSW 4 56744116 nonsense probably null
R7168:Actl7a UTSW 4 56743769 missense probably benign
R7568:Actl7a UTSW 4 56744498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTATGTCCAAGGATAGGC -3'
(R):5'- GTCTCAAACAGCATCTCGGC -3'

Sequencing Primer
(F):5'- CTATGTCCAAGGATAGGCCAAGAC -3'
(R):5'- AACAGCATCTCGGCGTACTTC -3'
Posted On2017-02-15