Incidental Mutation 'R5903:Oas1h'
ID456438
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120861421-120873506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120870977 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 250 (V250A)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: V250A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: V250A

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 120871834 missense probably damaging 1.00
IGL01890:Oas1h APN 5 120862789 unclassified probably null
IGL02745:Oas1h APN 5 120861479 missense probably benign 0.04
IGL02888:Oas1h APN 5 120861547 missense probably benign 0.34
IGL02970:Oas1h APN 5 120861635 missense possibly damaging 0.91
R0125:Oas1h UTSW 5 120862563 nonsense probably null
R1261:Oas1h UTSW 5 120871867 missense probably benign 0.01
R1506:Oas1h UTSW 5 120871888 missense possibly damaging 0.66
R1565:Oas1h UTSW 5 120862600 missense probably damaging 0.97
R1696:Oas1h UTSW 5 120862822 critical splice donor site probably null
R1750:Oas1h UTSW 5 120871777 splice site probably null
R3116:Oas1h UTSW 5 120861616 nonsense probably null
R4814:Oas1h UTSW 5 120862665 missense probably damaging 0.99
R4906:Oas1h UTSW 5 120867109 nonsense probably null
R4944:Oas1h UTSW 5 120862783 missense probably damaging 1.00
R4961:Oas1h UTSW 5 120871096 missense probably damaging 1.00
R5160:Oas1h UTSW 5 120871082 missense probably damaging 1.00
R5698:Oas1h UTSW 5 120870982 missense probably damaging 1.00
R6014:Oas1h UTSW 5 120867166 missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120861465 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGGCTATAGCAGAGGAGGG -3'
(R):5'- GTGGAGACAAGCTACCTGACTC -3'

Sequencing Primer
(F):5'- GACTGAGTCTAAATAACTGGCTGTG -3'
(R):5'- GGAGACAAGCTACCTGACTCTTTTG -3'
Posted On2017-02-15