Incidental Mutation 'R5903:Cntn3'
ID 456442
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Name contactin 3
Synonyms Pang
MMRRC Submission 044101-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5903 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 102162655-102573101 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102242133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 509 (M509L)
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
AlphaFold Q07409
Predicted Effect probably benign
Transcript: ENSMUST00000032159
AA Change: M509L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: M509L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203619
AA Change: M509L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: M509L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102420262 nonsense probably null
IGL00706:Cntn3 APN 6 102203949 missense probably benign 0.11
IGL01071:Cntn3 APN 6 102420251 critical splice donor site probably null
IGL01769:Cntn3 APN 6 102208184 missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102203885 missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102199360 splice site probably benign
IGL02736:Cntn3 APN 6 102203939 missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102278301 missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102168933 missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102187099 missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102209274 missense probably damaging 1.00
PIT4431001:Cntn3 UTSW 6 102464566 missense probably benign 0.22
R0314:Cntn3 UTSW 6 102420381 missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102277316 missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102203966 missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R0543:Cntn3 UTSW 6 102269090 splice site probably benign
R0629:Cntn3 UTSW 6 102203976 missense probably damaging 1.00
R0691:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0693:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1110:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1144:Cntn3 UTSW 6 102242126 missense possibly damaging 0.65
R1503:Cntn3 UTSW 6 102464565 nonsense probably null
R1640:Cntn3 UTSW 6 102242013 missense possibly damaging 0.82
R1681:Cntn3 UTSW 6 102170668 missense probably damaging 1.00
R1770:Cntn3 UTSW 6 102269205 missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102245071 missense probably benign 0.11
R1930:Cntn3 UTSW 6 102242053 nonsense probably null
R2026:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102206537 missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102203928 missense probably benign
R2351:Cntn3 UTSW 6 102337383 missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102208077 missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102199351 missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102464547 missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102168982 missense probably benign 0.37
R4678:Cntn3 UTSW 6 102204020 missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102165331 missense probably benign 0.37
R4720:Cntn3 UTSW 6 102242022 missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102267428 missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102169025 missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102278353 missense probably benign 0.01
R5502:Cntn3 UTSW 6 102265334 missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102420416 missense probably damaging 1.00
R6193:Cntn3 UTSW 6 102208131 missense probably benign 0.31
R6258:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6260:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6350:Cntn3 UTSW 6 102170618 missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102278340 missense probably damaging 0.99
R6993:Cntn3 UTSW 6 102278404 missense probably damaging 0.98
R7064:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R7085:Cntn3 UTSW 6 102165401 missense possibly damaging 0.85
R7174:Cntn3 UTSW 6 102165344 missense probably benign
R7208:Cntn3 UTSW 6 102278422 nonsense probably null
R7395:Cntn3 UTSW 6 102337394 critical splice acceptor site probably null
R7447:Cntn3 UTSW 6 102278455 nonsense probably null
R7571:Cntn3 UTSW 6 102278403 missense probably damaging 1.00
R7586:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R7614:Cntn3 UTSW 6 102165376 missense probably benign 0.17
R7697:Cntn3 UTSW 6 102208166 missense probably damaging 1.00
R7697:Cntn3 UTSW 6 102208167 missense probably damaging 1.00
R7849:Cntn3 UTSW 6 102265431 missense probably benign 0.00
R8011:Cntn3 UTSW 6 102437899 missense possibly damaging 0.93
R8013:Cntn3 UTSW 6 102199317 missense probably benign 0.00
R8377:Cntn3 UTSW 6 102209293 missense probably benign 0.00
R8726:Cntn3 UTSW 6 102169053 nonsense probably null
R8770:Cntn3 UTSW 6 102277316 missense possibly damaging 0.67
R8827:Cntn3 UTSW 6 102269133 missense probably benign 0.01
R8947:Cntn3 UTSW 6 102437903 missense probably damaging 1.00
R8997:Cntn3 UTSW 6 102204062 missense probably damaging 0.98
R9055:Cntn3 UTSW 6 102267437 missense probably benign 0.38
R9061:Cntn3 UTSW 6 102337327 missense probably damaging 1.00
R9758:Cntn3 UTSW 6 102206550 missense probably damaging 1.00
R9762:Cntn3 UTSW 6 102277235 missense probably damaging 1.00
Z1088:Cntn3 UTSW 6 102420294 missense possibly damaging 0.74
Z1176:Cntn3 UTSW 6 102437931 critical splice acceptor site probably null
Z1177:Cntn3 UTSW 6 102337331 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGCACAGGCATCTTTAATAGAAAGG -3'
(R):5'- CCCAGGAAAATATTATGAGGTCCC -3'

Sequencing Primer
(F):5'- CTGTAAGGGCTCCATTGA -3'
(R):5'- GGTGTATTGTACACATGCCT -3'
Posted On 2017-02-15