Mutagenetix > Incidental Mutation

Incidental Mutation 'R5903:Cntn3'

456442

Institutional Source

Beutler Lab

Gene Symbol

Cntn3

Ensembl Gene

ENSMUSG00000030075

Gene Name

contactin 3

Synonyms

Pang

MMRRC Submission

044101-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102162655-102573101 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102242133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 509 (M509L)

Ref Sequence

ENSEMBL: ENSMUSP00000145176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]

AlphaFold

Q07409

Predicted Effect

probably benign
Transcript: ENSMUST00000032159
AA Change: M509L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: M509L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203619
AA Change: M509L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: M509L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Cntn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Cntn3	APN	6	102420262	nonsense	probably null
IGL00706:Cntn3	APN	6	102203949	missense	probably benign	0.11
IGL01071:Cntn3	APN	6	102420251	critical splice donor site	probably null
IGL01769:Cntn3	APN	6	102208184	missense	probably damaging	1.00
IGL01995:Cntn3	APN	6	102203885	missense	probably damaging	1.00
IGL02058:Cntn3	APN	6	102199360	splice site	probably benign
IGL02736:Cntn3	APN	6	102203939	missense	probably damaging	1.00
IGL02955:Cntn3	APN	6	102278301	missense	probably damaging	1.00
IGL02971:Cntn3	APN	6	102168933	missense	probably damaging	1.00
IGL03208:Cntn3	APN	6	102187099	missense	probably damaging	0.99
P0037:Cntn3	UTSW	6	102209274	missense	probably damaging	1.00
PIT4431001:Cntn3	UTSW	6	102464566	missense	probably benign	0.22
R0314:Cntn3	UTSW	6	102420381	missense	probably damaging	1.00
R0388:Cntn3	UTSW	6	102277316	missense	probably damaging	0.96
R0483:Cntn3	UTSW	6	102203966	missense	probably damaging	1.00
R0539:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R0543:Cntn3	UTSW	6	102269090	splice site	probably benign
R0629:Cntn3	UTSW	6	102203976	missense	probably damaging	1.00
R0691:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0693:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0781:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1110:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1144:Cntn3	UTSW	6	102242126	missense	possibly damaging	0.65
R1503:Cntn3	UTSW	6	102464565	nonsense	probably null
R1640:Cntn3	UTSW	6	102242013	missense	possibly damaging	0.82
R1681:Cntn3	UTSW	6	102170668	missense	probably damaging	1.00
R1770:Cntn3	UTSW	6	102269205	missense	possibly damaging	0.49
R1782:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R1861:Cntn3	UTSW	6	102245071	missense	probably benign	0.11
R1930:Cntn3	UTSW	6	102242053	nonsense	probably null
R2026:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R2152:Cntn3	UTSW	6	102206537	missense	probably damaging	1.00
R2313:Cntn3	UTSW	6	102203928	missense	probably benign
R2351:Cntn3	UTSW	6	102337383	missense	possibly damaging	0.55
R3611:Cntn3	UTSW	6	102208077	missense	possibly damaging	0.77
R4349:Cntn3	UTSW	6	102199351	missense	probably damaging	1.00
R4421:Cntn3	UTSW	6	102464547	missense	probably damaging	0.97
R4513:Cntn3	UTSW	6	102168982	missense	probably benign	0.37
R4678:Cntn3	UTSW	6	102204020	missense	probably damaging	1.00
R4702:Cntn3	UTSW	6	102165331	missense	probably benign	0.37
R4720:Cntn3	UTSW	6	102242022	missense	possibly damaging	0.65
R4879:Cntn3	UTSW	6	102267428	missense	possibly damaging	0.47
R4951:Cntn3	UTSW	6	102169025	missense	possibly damaging	0.90
R5410:Cntn3	UTSW	6	102278353	missense	probably benign	0.01
R5502:Cntn3	UTSW	6	102265334	missense	possibly damaging	0.58
R5852:Cntn3	UTSW	6	102420416	missense	probably damaging	1.00
R6193:Cntn3	UTSW	6	102208131	missense	probably benign	0.31
R6258:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6260:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6350:Cntn3	UTSW	6	102170618	missense	probably damaging	1.00
R6490:Cntn3	UTSW	6	102278340	missense	probably damaging	0.99
R6993:Cntn3	UTSW	6	102278404	missense	probably damaging	0.98
R7064:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R7085:Cntn3	UTSW	6	102165401	missense	possibly damaging	0.85
R7174:Cntn3	UTSW	6	102165344	missense	probably benign
R7208:Cntn3	UTSW	6	102278422	nonsense	probably null
R7395:Cntn3	UTSW	6	102337394	critical splice acceptor site	probably null
R7447:Cntn3	UTSW	6	102278455	nonsense	probably null
R7571:Cntn3	UTSW	6	102278403	missense	probably damaging	1.00
R7586:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R7614:Cntn3	UTSW	6	102165376	missense	probably benign	0.17
R7697:Cntn3	UTSW	6	102208166	missense	probably damaging	1.00
R7697:Cntn3	UTSW	6	102208167	missense	probably damaging	1.00
R7849:Cntn3	UTSW	6	102265431	missense	probably benign	0.00
R8011:Cntn3	UTSW	6	102437899	missense	possibly damaging	0.93
R8013:Cntn3	UTSW	6	102199317	missense	probably benign	0.00
R8377:Cntn3	UTSW	6	102209293	missense	probably benign	0.00
R8726:Cntn3	UTSW	6	102169053	nonsense	probably null
R8770:Cntn3	UTSW	6	102277316	missense	possibly damaging	0.67
R8827:Cntn3	UTSW	6	102269133	missense	probably benign	0.01
R8947:Cntn3	UTSW	6	102437903	missense	probably damaging	1.00
R8997:Cntn3	UTSW	6	102204062	missense	probably damaging	0.98
R9055:Cntn3	UTSW	6	102267437	missense	probably benign	0.38
R9061:Cntn3	UTSW	6	102337327	missense	probably damaging	1.00
R9758:Cntn3	UTSW	6	102206550	missense	probably damaging	1.00
R9762:Cntn3	UTSW	6	102277235	missense	probably damaging	1.00
Z1088:Cntn3	UTSW	6	102420294	missense	possibly damaging	0.74
Z1176:Cntn3	UTSW	6	102437931	critical splice acceptor site	probably null
Z1177:Cntn3	UTSW	6	102337331	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GGCACAGGCATCTTTAATAGAAAGG -3'
(R):5'- CCCAGGAAAATATTATGAGGTCCC -3'

Sequencing Primer
(F):5'- CTGTAAGGGCTCCATTGA -3'
(R):5'- GGTGTATTGTACACATGCCT -3'

Posted On

2017-02-15