Incidental Mutation 'R5903:Atg7'
ID456444
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Nameautophagy related 7
Synonyms1810013K23Rik, Apg7l
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location114643097-114860614 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 114706293 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 439 (W439*)
Ref Sequence ENSEMBL: ENSMUSP00000138600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182428] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
Predicted Effect probably null
Transcript: ENSMUST00000032457
AA Change: W478*
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314
AA Change: W478*

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169310
AA Change: W521*
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314
AA Change: W521*

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182428
AA Change: W478*
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314
AA Change: W478*

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182793
AA Change: W478*
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314
AA Change: W478*

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182902
AA Change: W478*
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314
AA Change: W478*

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183165
AA Change: W439*
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314
AA Change: W439*

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203130
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114724923 missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114703364 missense probably damaging 0.99
R1467:Atg7 UTSW 6 114858982 splice site probably benign
R1561:Atg7 UTSW 6 114701172 missense possibly damaging 0.52
R1755:Atg7 UTSW 6 114673677 missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114701235 missense probably damaging 0.98
R1962:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R1964:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R2064:Atg7 UTSW 6 114703363 missense probably damaging 1.00
R3722:Atg7 UTSW 6 114695663 missense probably damaging 0.99
R3870:Atg7 UTSW 6 114697047 missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114701978 missense probably benign 0.00
R4111:Atg7 UTSW 6 114713294 missense probably damaging 0.98
R4212:Atg7 UTSW 6 114703425 missense probably benign 0.02
R4943:Atg7 UTSW 6 114697084 missense probably benign 0.25
R5216:Atg7 UTSW 6 114724949 missense probably damaging 0.96
R5465:Atg7 UTSW 6 114652532 missense probably benign
R5555:Atg7 UTSW 6 114702053 missense probably damaging 1.00
R5618:Atg7 UTSW 6 114673699 missense probably damaging 0.99
R5902:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R5980:Atg7 UTSW 6 114680236 missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6178:Atg7 UTSW 6 114724895 missense probably damaging 1.00
R6702:Atg7 UTSW 6 114671097 splice site probably null
R6924:Atg7 UTSW 6 114709211 critical splice donor site probably null
R6941:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114777057 missense probably damaging 1.00
R7561:Atg7 UTSW 6 114673041 missense possibly damaging 0.80
Z1088:Atg7 UTSW 6 114695686 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCACTGTGCAAAGAGGAATTCC -3'
(R):5'- ACCCATTGCAGGTTGATGGC -3'

Sequencing Primer
(F):5'- AAGTGGGGTCATTGCTTCCC -3'
(R):5'- TTGATGGCAGGAAGTAAAGAGCTCC -3'
Posted On2017-02-15