Incidental Mutation 'R5903:Clec4d'
ID456445
Institutional Source Beutler Lab
Gene Symbol Clec4d
Ensembl Gene ENSMUSG00000030144
Gene NameC-type lectin domain family 4, member d
SynonymsClecsf8, mcl, Mpcl, mMCL
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123262111-123275265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123267061 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 43 (H43R)
Ref Sequence ENSEMBL: ENSMUSP00000032240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032240] [ENSMUST00000204826]
Predicted Effect probably damaging
Transcript: ENSMUST00000032240
AA Change: H43R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032240
Gene: ENSMUSG00000030144
AA Change: H43R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 83 207 1.59e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203421
Predicted Effect possibly damaging
Transcript: ENSMUST00000204826
AA Change: H43R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145134
Gene: ENSMUSG00000030144
AA Change: H43R

DomainStartEndE-ValueType
Blast:CLECT 28 77 1e-8 BLAST
Meta Mutation Damage Score 0.4025 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to trehalose-6,60'-dimycolate treatment. Mice homozygous for a different knock-out allele exhibit increased susceptibility to pneumonia infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Clec4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Clec4d APN 6 123274773 missense probably damaging 1.00
R0111:Clec4d UTSW 6 123268047 nonsense probably null
R0157:Clec4d UTSW 6 123267136 missense probably benign 0.00
R1756:Clec4d UTSW 6 123267109 missense probably damaging 0.99
R1928:Clec4d UTSW 6 123267161 splice site probably null
R1964:Clec4d UTSW 6 123262360 missense probably benign 0.05
R2208:Clec4d UTSW 6 123265355 missense probably damaging 0.98
R2443:Clec4d UTSW 6 123268117 missense probably benign 0.32
R4740:Clec4d UTSW 6 123268113 missense probably damaging 1.00
R5101:Clec4d UTSW 6 123267112 missense probably damaging 1.00
R5692:Clec4d UTSW 6 123268145 critical splice donor site probably null
R5785:Clec4d UTSW 6 123274770 missense probably benign 0.09
R6005:Clec4d UTSW 6 123267159 missense probably damaging 0.99
R6209:Clec4d UTSW 6 123270529 intron probably null
R7760:Clec4d UTSW 6 123270341 missense probably benign 0.01
R7867:Clec4d UTSW 6 123267164 critical splice donor site probably null
R7950:Clec4d UTSW 6 123267164 critical splice donor site probably null
Z1176:Clec4d UTSW 6 123274686
Z1177:Clec4d UTSW 6 123268074
Predicted Primers PCR Primer
(F):5'- GTGCACTTAAAAGGTTCCAAAAGTTCC -3'
(R):5'- TGCAGCCAGTTCTCATTCTG -3'

Sequencing Primer
(F):5'- GGTTCCAAAAGTTCCAATGTAAATC -3'
(R):5'- TCTGACAGATGCTATCTAAAGGCTGG -3'
Posted On2017-02-15