Incidental Mutation 'R5903:Hsd17b14'
ID456446
Institutional Source Beutler Lab
Gene Symbol Hsd17b14
Ensembl Gene ENSMUSG00000030825
Gene Namehydroxysteroid (17-beta) dehydrogenase 14
Synonyms0610039E24Rik, Dhrs10, retSDR3
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5903 (G1)
Quality Score166
Status Validated
Chromosome7
Chromosomal Location45554893-45567752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45565962 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 161 (V161A)
Ref Sequence ENSEMBL: ENSMUSP00000103381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000107752] [ENSMUST00000120864] [ENSMUST00000210300]
Predicted Effect probably benign
Transcript: ENSMUST00000033098
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107752
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825
AA Change: V161A

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115479
AA Change: V127A
Predicted Effect probably benign
Transcript: ENSMUST00000120864
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147958
AA Change: V71A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209910
Predicted Effect probably benign
Transcript: ENSMUST00000210300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210866
Predicted Effect probably benign
Transcript: ENSMUST00000210997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211521
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
PHENOTYPE: In a high-throughput phenotyping screen, male null mice exhibit infertility, decreased sperm production, testicular degeneration and an increased anxiety-like response to stress-induced hyperthermia. Homozygous null mice also show an increase in serum IgG2a in response to antigen challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Hsd17b14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hsd17b14 APN 7 45566713 missense possibly damaging 0.72
IGL02504:Hsd17b14 APN 7 45556375 missense possibly damaging 0.84
IGL03126:Hsd17b14 APN 7 45556079 missense possibly damaging 0.83
IGL03279:Hsd17b14 APN 7 45566193 missense possibly damaging 0.72
IGL03493:Hsd17b14 APN 7 45556091 missense probably damaging 1.00
R0085:Hsd17b14 UTSW 7 45556410 unclassified probably benign
R4128:Hsd17b14 UTSW 7 45563008 missense probably damaging 1.00
R4513:Hsd17b14 UTSW 7 45562915 missense probably benign 0.24
R6649:Hsd17b14 UTSW 7 45556076 missense probably damaging 1.00
R6899:Hsd17b14 UTSW 7 45562928 missense possibly damaging 0.90
R7541:Hsd17b14 UTSW 7 45566146 missense probably damaging 1.00
R7829:Hsd17b14 UTSW 7 45566785 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCATCATGTAGTCTTGAATTCTGGC -3'
(R):5'- TGCAAGCTCTTCCCACAGTG -3'

Sequencing Primer
(F):5'- TCTGGCAATCGGTAACAAACTG -3'
(R):5'- CCACAGTGGAGTCCAGATGTTTC -3'
Posted On2017-02-15