Incidental Mutation 'R5903:Olfr618'
ID456447
Institutional Source Beutler Lab
Gene Symbol Olfr618
Ensembl Gene ENSMUSG00000073945
Gene Nameolfactory receptor 618
SynonymsMOR31-9, GA_x6K02T2PBJ9-6320148-6321104
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103590103-103600448 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 103597921 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 202 (G202*)
Ref Sequence ENSEMBL: ENSMUSP00000151147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098197] [ENSMUST00000214883] [ENSMUST00000215732]
Predicted Effect probably null
Transcript: ENSMUST00000098197
AA Change: G202*
SMART Domains Protein: ENSMUSP00000095799
Gene: ENSMUSG00000073945
AA Change: G202*

DomainStartEndE-ValueType
Pfam:7tm_4 34 314 3.1e-109 PFAM
Pfam:7TM_GPCR_Srsx 38 311 6.3e-12 PFAM
Pfam:7tm_1 44 296 8.2e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214883
AA Change: G202*
Predicted Effect probably benign
Transcript: ENSMUST00000215732
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Olfr618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr618 APN 7 103598162 missense possibly damaging 0.65
IGL00963:Olfr618 APN 7 103597637 unclassified probably null
IGL01772:Olfr618 APN 7 103597913 missense probably benign 0.12
IGL02014:Olfr618 APN 7 103597730 missense probably damaging 1.00
IGL03409:Olfr618 APN 7 103597367 missense possibly damaging 0.51
R0087:Olfr618 UTSW 7 103597721 missense probably benign 0.44
R0831:Olfr618 UTSW 7 103598131 missense probably benign 0.02
R1779:Olfr618 UTSW 7 103597900 missense probably damaging 1.00
R1909:Olfr618 UTSW 7 103597343 missense probably benign 0.01
R5952:Olfr618 UTSW 7 103597967 missense probably damaging 1.00
R6328:Olfr618 UTSW 7 103597866 missense probably damaging 1.00
R7264:Olfr618 UTSW 7 103597748 missense probably damaging 0.97
R7573:Olfr618 UTSW 7 103597528 missense probably benign 0.08
R7870:Olfr618 UTSW 7 103598266 missense probably damaging 1.00
R7953:Olfr618 UTSW 7 103598266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAATGGGCATTGCATC -3'
(R):5'- AGAATGTGCATGTGACGTGG -3'

Sequencing Primer
(F):5'- GCATTGCATCTGTGACTAGAAGC -3'
(R):5'- TATGGTGTGGCCCCCAAAAC -3'
Posted On2017-02-15