Mutagenetix > Incidental Mutations

Incidental Mutation 'R5903:Ipo7'

456448

Institutional Source

Beutler Lab

Gene Symbol

Ipo7

Ensembl Gene

ENSMUSG00000066232

Gene Name

importin 7

Synonyms

A330055O14Rik, Imp7, RanBP7

MMRRC Submission

044101-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110018274-110056609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110050813 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 736 (C736S)

Ref Sequence

ENSEMBL: ENSMUSP00000081782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082517

Predicted Effect

probably damaging
Transcript: ENSMUST00000084731
AA Change: C736S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: C736S

Domain	Start	End	E-Value	Type
IBN_N	22	101	3.06e-15	SMART
Pfam:Cse1	168	452	2.8e-12	PFAM
low complexity region	701	712	N/A	INTRINSIC
low complexity region	881	900	N/A	INTRINSIC
low complexity region	923	939	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208821

Predicted Effect

probably benign
Transcript: ENSMUST00000208951

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Ipo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01796:Ipo7	APN	7	110029848	intron	probably benign
IGL02472:Ipo7	APN	7	110040853	missense	probably damaging	1.00
IGL02502:Ipo7	APN	7	110051050	missense	probably damaging	1.00
IGL02514:Ipo7	APN	7	110048828	missense	possibly damaging	0.78
IGL02535:Ipo7	APN	7	110054026	missense	probably damaging	0.98
IGL02961:Ipo7	APN	7	110047016	missense	probably benign	0.02
R0089:Ipo7	UTSW	7	110050765	intron	probably benign
R0355:Ipo7	UTSW	7	110049661	missense	probably benign	0.00
R0565:Ipo7	UTSW	7	110049593	intron	probably benign
R1342:Ipo7	UTSW	7	110029804	missense	possibly damaging	0.82
R1405:Ipo7	UTSW	7	110029841	missense	probably benign	0.03
R1405:Ipo7	UTSW	7	110039249	missense	probably damaging	0.97
R1405:Ipo7	UTSW	7	110029841	missense	probably benign	0.03
R1405:Ipo7	UTSW	7	110039249	missense	probably damaging	0.97
R1791:Ipo7	UTSW	7	110027132	missense	probably damaging	0.98
R1838:Ipo7	UTSW	7	110042109	missense	probably damaging	1.00
R2116:Ipo7	UTSW	7	110051118	missense	probably damaging	0.99
R2120:Ipo7	UTSW	7	110049631	missense	probably damaging	1.00
R4366:Ipo7	UTSW	7	110029712	missense	possibly damaging	0.58
R4366:Ipo7	UTSW	7	110048216	missense	possibly damaging	0.88
R4805:Ipo7	UTSW	7	110051484	missense	probably benign	0.16
R5228:Ipo7	UTSW	7	110046762	missense	probably benign	0.00
R5976:Ipo7	UTSW	7	110048807	missense	probably damaging	1.00
R6254:Ipo7	UTSW	7	110049060	missense	probably benign	0.00
R6335:Ipo7	UTSW	7	110018468	missense	possibly damaging	0.92
R6360:Ipo7	UTSW	7	110027129	missense	probably damaging	1.00
R6776:Ipo7	UTSW	7	110047065	missense	probably damaging	0.98
R7132:Ipo7	UTSW	7	110054047	missense	probably benign	0.17
R7329:Ipo7	UTSW	7	110049017	missense	possibly damaging	0.94
R7491:Ipo7	UTSW	7	110039194	missense	possibly damaging	0.91
R7763:Ipo7	UTSW	7	110052799	missense	possibly damaging	0.62
RF017:Ipo7	UTSW	7	110048794	missense	probably benign	0.00
X0062:Ipo7	UTSW	7	110052886	missense	probably damaging	1.00
X0066:Ipo7	UTSW	7	110052734	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGTAGCACAAATGACATCTAACCTC -3'
(R):5'- TGCTTCCACGAATAATGGTATACAC -3'

Sequencing Primer
(F):5'- GCACAAATGACATCTAACCTCATTAC -3'
(R):5'- TGGTATACACTGTAAAGAGAGA -3'

Posted On

2017-02-15