Incidental Mutation 'R5903:Sez6l2'
ID456449
Institutional Source Beutler Lab
Gene Symbol Sez6l2
Ensembl Gene ENSMUSG00000030683
Gene Nameseizure related 6 homolog like 2
SynonymsPsk1
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126950563-126970606 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 126970133 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335] [ENSMUST00000205437] [ENSMUST00000205903] [ENSMUST00000206296] [ENSMUST00000206816]
Predicted Effect probably benign
Transcript: ENSMUST00000106332
SMART Domains Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
CUB 113 226 8.25e-4 SMART
CCP 230 285 3.75e-15 SMART
CUB 289 399 1.3e-3 SMART
CCP 404 463 8.9e-8 SMART
CUB 467 578 3.45e-14 SMART
CCP 584 639 1.18e-12 SMART
CCP 645 704 1.31e-14 SMART
CCP 711 768 2.76e-13 SMART
transmembrane domain 798 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106333
SMART Domains Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 858 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106335
SMART Domains Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 845 867 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134471
Predicted Effect probably benign
Transcript: ENSMUST00000155138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181859
Predicted Effect probably benign
Transcript: ENSMUST00000205437
Predicted Effect probably benign
Transcript: ENSMUST00000205903
Predicted Effect probably benign
Transcript: ENSMUST00000206296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206667
Predicted Effect probably benign
Transcript: ENSMUST00000206816
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Sez6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Sez6l2 APN 7 126961883 missense possibly damaging 0.91
IGL01710:Sez6l2 APN 7 126968216 missense probably damaging 1.00
IGL02439:Sez6l2 APN 7 126968189 missense probably damaging 0.99
IGL02752:Sez6l2 APN 7 126953733 missense probably damaging 1.00
H8786:Sez6l2 UTSW 7 126961783 missense possibly damaging 0.95
R0783:Sez6l2 UTSW 7 126967145 missense possibly damaging 0.65
R0989:Sez6l2 UTSW 7 126959844 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1493:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1509:Sez6l2 UTSW 7 126963363 missense probably damaging 1.00
R1704:Sez6l2 UTSW 7 126958341 missense probably damaging 1.00
R1817:Sez6l2 UTSW 7 126967119 missense probably damaging 1.00
R1889:Sez6l2 UTSW 7 126953496 missense probably damaging 1.00
R2509:Sez6l2 UTSW 7 126953772 missense probably benign 0.31
R3772:Sez6l2 UTSW 7 126959203 missense probably damaging 0.99
R4466:Sez6l2 UTSW 7 126959851 missense probably damaging 0.97
R4869:Sez6l2 UTSW 7 126961842 missense probably benign 0.02
R5155:Sez6l2 UTSW 7 126962373 missense probably damaging 0.99
R5416:Sez6l2 UTSW 7 126961886 missense probably damaging 1.00
R5551:Sez6l2 UTSW 7 126966830 missense probably damaging 1.00
R5884:Sez6l2 UTSW 7 126970156 unclassified probably benign
R6015:Sez6l2 UTSW 7 126953453 missense probably damaging 0.97
R6726:Sez6l2 UTSW 7 126968005 missense probably damaging 0.96
R7094:Sez6l2 UTSW 7 126952924 missense probably damaging 0.99
R7117:Sez6l2 UTSW 7 126953743 missense possibly damaging 0.94
R7228:Sez6l2 UTSW 7 126953725 missense probably damaging 1.00
R7479:Sez6l2 UTSW 7 126963659 missense probably damaging 1.00
R7502:Sez6l2 UTSW 7 126961743 missense probably benign 0.26
Z1176:Sez6l2 UTSW 7 126958331 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGACTGAACTTAGTGCCTTATG -3'
(R):5'- GACCCCTTGTTTGGCAACTAAG -3'

Sequencing Primer
(F):5'- GACAAGAGTCTCTCTATAGCTCTGG -3'
(R):5'- CCCTTGTTTGGCAACTAAGCAGAG -3'
Posted On2017-02-15