Mutagenetix > Incidental Mutations

Incidental Mutation 'R5903:Sez6l2'

456449

Institutional Source

Beutler Lab

Gene Symbol

Sez6l2

Ensembl Gene

ENSMUSG00000030683

Gene Name

seizure related 6 homolog like 2

Synonyms

Psk1

MMRRC Submission

044101-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126950563-126970606 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 126970133 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335] [ENSMUST00000205437] [ENSMUST00000205903] [ENSMUST00000206296] [ENSMUST00000206816]

Predicted Effect

probably benign
Transcript: ENSMUST00000106332

SMART Domains

Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	70	86	N/A	INTRINSIC
low complexity region	93	108	N/A	INTRINSIC
CUB	113	226	8.25e-4	SMART
CCP	230	285	3.75e-15	SMART
CUB	289	399	1.3e-3	SMART
CCP	404	463	8.9e-8	SMART
CUB	467	578	3.45e-14	SMART
CCP	584	639	1.18e-12	SMART
CCP	645	704	1.31e-14	SMART
CCP	711	768	2.76e-13	SMART
transmembrane domain	798	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106333

SMART Domains

Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	115	146	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
CUB	173	286	8.25e-4	SMART
CCP	290	345	3.75e-15	SMART
CUB	349	459	1.3e-3	SMART
CCP	464	523	8.9e-8	SMART
CUB	527	638	3.45e-14	SMART
CCP	644	699	1.18e-12	SMART
CCP	705	764	1.31e-14	SMART
CCP	771	828	2.76e-13	SMART
transmembrane domain	858	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106335

SMART Domains

Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	115	146	N/A	INTRINSIC
low complexity region	153	168	N/A	INTRINSIC
CUB	173	286	8.25e-4	SMART
CCP	290	345	3.75e-15	SMART
CUB	349	459	1.3e-3	SMART
CCP	464	523	8.9e-8	SMART
CUB	527	638	3.45e-14	SMART
CCP	644	699	1.18e-12	SMART
CCP	705	764	1.31e-14	SMART
CCP	771	828	2.76e-13	SMART
transmembrane domain	845	867	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134471

Predicted Effect

probably benign
Transcript: ENSMUST00000155138

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180704

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181859

Predicted Effect

probably benign
Transcript: ENSMUST00000205437

Predicted Effect

probably benign
Transcript: ENSMUST00000205903

Predicted Effect

probably benign
Transcript: ENSMUST00000206296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206667

Predicted Effect

probably benign
Transcript: ENSMUST00000206816

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Sez6l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01444:Sez6l2	APN	7	126961883	missense	possibly damaging	0.91
IGL01710:Sez6l2	APN	7	126968216	missense	probably damaging	1.00
IGL02439:Sez6l2	APN	7	126968189	missense	probably damaging	0.99
IGL02752:Sez6l2	APN	7	126953733	missense	probably damaging	1.00
H8786:Sez6l2	UTSW	7	126961783	missense	possibly damaging	0.95
R0783:Sez6l2	UTSW	7	126967145	missense	possibly damaging	0.65
R0989:Sez6l2	UTSW	7	126959844	missense	probably damaging	1.00
R1148:Sez6l2	UTSW	7	126961812	missense	probably damaging	1.00
R1148:Sez6l2	UTSW	7	126961812	missense	probably damaging	1.00
R1493:Sez6l2	UTSW	7	126961812	missense	probably damaging	1.00
R1509:Sez6l2	UTSW	7	126963363	missense	probably damaging	1.00
R1704:Sez6l2	UTSW	7	126958341	missense	probably damaging	1.00
R1817:Sez6l2	UTSW	7	126967119	missense	probably damaging	1.00
R1889:Sez6l2	UTSW	7	126953496	missense	probably damaging	1.00
R2509:Sez6l2	UTSW	7	126953772	missense	probably benign	0.31
R3772:Sez6l2	UTSW	7	126959203	missense	probably damaging	0.99
R4466:Sez6l2	UTSW	7	126959851	missense	probably damaging	0.97
R4869:Sez6l2	UTSW	7	126961842	missense	probably benign	0.02
R5155:Sez6l2	UTSW	7	126962373	missense	probably damaging	0.99
R5416:Sez6l2	UTSW	7	126961886	missense	probably damaging	1.00
R5551:Sez6l2	UTSW	7	126966830	missense	probably damaging	1.00
R5884:Sez6l2	UTSW	7	126970156	unclassified	probably benign
R6015:Sez6l2	UTSW	7	126953453	missense	probably damaging	0.97
R6726:Sez6l2	UTSW	7	126968005	missense	probably damaging	0.96
R7094:Sez6l2	UTSW	7	126952924	missense	probably damaging	0.99
R7117:Sez6l2	UTSW	7	126953743	missense	possibly damaging	0.94
R7228:Sez6l2	UTSW	7	126953725	missense	probably damaging	1.00
R7479:Sez6l2	UTSW	7	126963659	missense	probably damaging	1.00
R7502:Sez6l2	UTSW	7	126961743	missense	probably benign	0.26
R8321:Sez6l2	UTSW	7	126958416	missense	probably damaging	0.99
Z1176:Sez6l2	UTSW	7	126958331	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGAGACTGAACTTAGTGCCTTATG -3'
(R):5'- GACCCCTTGTTTGGCAACTAAG -3'

Sequencing Primer
(F):5'- GACAAGAGTCTCTCTATAGCTCTGG -3'
(R):5'- CCCTTGTTTGGCAACTAAGCAGAG -3'

Posted On

2017-02-15