Incidental Mutation 'R5903:Thsd4'
ID456451
Institutional Source Beutler Lab
Gene Symbol Thsd4
Ensembl Gene ENSMUSG00000032289
Gene Namethrombospondin, type I, domain containing 4
SynonymsADAMTSL6, B230114P05Rik
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5903 (G1)
Quality Score200
Status Validated
Chromosome9
Chromosomal Location59966931-60522046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60394106 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 302 (N302I)
Ref Sequence ENSEMBL: ENSMUSP00000131418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098660] [ENSMUST00000171654]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098660
AA Change: N302I

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096257
Gene: ENSMUSG00000032289
AA Change: N302I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 1.5e-39 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 974 1006 4.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171654
AA Change: N302I

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131418
Gene: ENSMUSG00000032289
AA Change: N302I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 5.4e-40 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 975 1005 1.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216899
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Thsd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Thsd4 APN 9 60394115 missense probably benign 0.22
IGL02418:Thsd4 APN 9 60428315 missense probably damaging 0.99
IGL02491:Thsd4 APN 9 60000018 missense probably damaging 0.99
IGL02754:Thsd4 APN 9 59989097 splice site probably benign
IGL02874:Thsd4 APN 9 60252730 missense probably damaging 1.00
IGL02978:Thsd4 APN 9 60056846 splice site probably null
IGL03139:Thsd4 APN 9 59997173 missense probably benign 0.01
R0266:Thsd4 UTSW 9 59997134 missense probably benign 0.07
R0482:Thsd4 UTSW 9 60002978 missense probably damaging 1.00
R1188:Thsd4 UTSW 9 60394406 missense probably benign 0.12
R1447:Thsd4 UTSW 9 59997213 missense probably benign
R1572:Thsd4 UTSW 9 60394553 splice site probably benign
R1812:Thsd4 UTSW 9 60056937 missense probably damaging 1.00
R2349:Thsd4 UTSW 9 59972515 missense probably benign 0.05
R3236:Thsd4 UTSW 9 60394387 missense probably benign
R4088:Thsd4 UTSW 9 59997222 missense probably benign 0.02
R4884:Thsd4 UTSW 9 59988037 missense probably benign 0.43
R4886:Thsd4 UTSW 9 59989030 missense probably benign 0.00
R5066:Thsd4 UTSW 9 59976332 missense probably damaging 1.00
R5223:Thsd4 UTSW 9 60057042 missense probably damaging 1.00
R5441:Thsd4 UTSW 9 59979783 missense probably damaging 1.00
R5457:Thsd4 UTSW 9 59979777 missense probably damaging 1.00
R5574:Thsd4 UTSW 9 59972400 missense probably damaging 1.00
R5581:Thsd4 UTSW 9 59972458 missense possibly damaging 0.90
R6220:Thsd4 UTSW 9 59982747 missense probably damaging 1.00
R6728:Thsd4 UTSW 9 59997197 missense probably benign
R7102:Thsd4 UTSW 9 59976304 missense probably damaging 1.00
R7316:Thsd4 UTSW 9 59987359 missense probably benign 0.00
R7403:Thsd4 UTSW 9 60056887 missense probably damaging 0.99
R7638:Thsd4 UTSW 9 60394472 missense probably damaging 1.00
R7671:Thsd4 UTSW 9 60428174 missense probably benign
R7856:Thsd4 UTSW 9 60002861 missense probably damaging 1.00
R7939:Thsd4 UTSW 9 60002861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCGCTGCCACACAATTG -3'
(R):5'- ATCTACCAGCTGCCCTTGAC -3'

Sequencing Primer
(F):5'- TTGAGAACTCACTCTGTAGACCAGG -3'
(R):5'- AGCTGCCCTTGACTCACGAC -3'
Posted On2017-02-15