Incidental Mutation 'R5903:Hsf2'
ID456453
Institutional Source Beutler Lab
Gene Symbol Hsf2
Ensembl Gene ENSMUSG00000019878
Gene Nameheat shock factor 2
Synonyms
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location57486385-57513135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57504723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 218 (S218P)
Ref Sequence ENSEMBL: ENSMUSP00000152013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079833] [ENSMUST00000220042] [ENSMUST00000220353]
Predicted Effect probably benign
Transcript: ENSMUST00000079833
AA Change: S275P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078761
Gene: ENSMUSG00000019878
AA Change: S275P

DomainStartEndE-ValueType
HSF 6 110 1.99e-62 SMART
coiled coil region 133 176 N/A INTRINSIC
Pfam:Vert_HS_TF 230 392 1.5e-39 PFAM
Pfam:Vert_HS_TF 391 494 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219171
Predicted Effect probably benign
Transcript: ENSMUST00000220042
AA Change: S218P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220353
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased late-gestational lethality associated with collapsed lateral ventricles and ventricular bleeding. Survivors may show ventricular dilation, sterility in females, and reduced sperm counts in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Hsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Hsf2 APN 10 57512028 missense probably benign 0.00
IGL00965:Hsf2 APN 10 57512100 missense probably damaging 1.00
IGL01338:Hsf2 APN 10 57501379 missense probably damaging 1.00
IGL01518:Hsf2 APN 10 57512134 missense probably damaging 1.00
IGL01721:Hsf2 APN 10 57496181 missense probably benign 0.13
IGL02219:Hsf2 APN 10 57496274 missense probably damaging 1.00
IGL03493:Hsf2 APN 10 57505366 missense probably damaging 1.00
R0270:Hsf2 UTSW 10 57502639 missense probably benign 0.28
R1774:Hsf2 UTSW 10 57512146 missense probably damaging 1.00
R2406:Hsf2 UTSW 10 57497546 missense probably damaging 0.96
R3410:Hsf2 UTSW 10 57505282 missense probably damaging 1.00
R4829:Hsf2 UTSW 10 57496170 missense probably damaging 0.96
R4958:Hsf2 UTSW 10 57501371 missense probably damaging 0.99
R5154:Hsf2 UTSW 10 57504712 missense probably benign
R5237:Hsf2 UTSW 10 57506221 missense probably benign 0.16
R6125:Hsf2 UTSW 10 57512005 missense probably benign
R6126:Hsf2 UTSW 10 57495917 missense probably damaging 1.00
R6280:Hsf2 UTSW 10 57511495 missense probably benign 0.03
R6309:Hsf2 UTSW 10 57486580 start gained probably benign
R6954:Hsf2 UTSW 10 57504643 missense probably damaging 1.00
R6966:Hsf2 UTSW 10 57495984 missense probably damaging 1.00
R7088:Hsf2 UTSW 10 57512092 missense probably damaging 1.00
R7182:Hsf2 UTSW 10 57505176 missense possibly damaging 0.87
R7511:Hsf2 UTSW 10 57504557 missense probably benign 0.00
Z1088:Hsf2 UTSW 10 57496168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGTCATTCATCTTCAGGGTCTC -3'
(R):5'- GGTAGTTATCTGGGTCAATAATTCC -3'

Sequencing Primer
(F):5'- GACTGAGGACAAGCAGTTTTGTTTAC -3'
(R):5'- TCTGGGTCAATAATTCCAAATATGTG -3'
Posted On2017-02-15