Mutagenetix > Incidental Mutation

Incidental Mutation 'R5903:Psme4'

456456

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

044101-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30841589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1148 (N1148I)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: N1148I

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: N1148I

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCCTCATAGAAAGAAGCAGATG -3'
(R):5'- GCCTATTGAAGCAAACTGCCC -3'

Sequencing Primer
(F):5'- CTTCTGGGCAGGGGGAAATC -3'
(R):5'- TTGAAGCAAACTGCCCCTATAATTAC -3'

Posted On

2017-02-15