Incidental Mutation 'R5903:Atg2b'
ID456462
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Nameautophagy related 2B
Synonyms
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location105616136-105685211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105639359 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1449 (D1449G)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041055
AA Change: D1449G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: D1449G

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221015
AA Change: D288G
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105644916 missense probably benign 0.20
IGL01326:Atg2b APN 12 105622144 missense probably damaging 1.00
IGL02063:Atg2b APN 12 105648322 missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105636440 splice site probably benign
IGL02376:Atg2b APN 12 105645468 missense probably damaging 1.00
IGL02381:Atg2b APN 12 105648348 missense probably damaging 1.00
IGL02434:Atg2b APN 12 105639207 missense probably benign 0.00
IGL02534:Atg2b APN 12 105643267 missense probably damaging 1.00
IGL03011:Atg2b APN 12 105626362 missense probably damaging 0.98
IGL03173:Atg2b APN 12 105658294 missense possibly damaging 0.68
R6669_atg2b_067 UTSW 12 105671529 missense possibly damaging 0.90
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0511:Atg2b UTSW 12 105617153 missense probably damaging 1.00
R0762:Atg2b UTSW 12 105674970 missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105636508 missense probably benign 0.00
R1029:Atg2b UTSW 12 105635773 missense probably damaging 0.96
R1529:Atg2b UTSW 12 105661133 missense probably benign
R1563:Atg2b UTSW 12 105623488 missense probably damaging 0.99
R1746:Atg2b UTSW 12 105669329 missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105654092 missense probably benign 0.01
R1956:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R1957:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R2272:Atg2b UTSW 12 105638008 missense probably benign 0.00
R2877:Atg2b UTSW 12 105664009 nonsense probably null
R2878:Atg2b UTSW 12 105664009 nonsense probably null
R4798:Atg2b UTSW 12 105652629 missense probably benign 0.37
R4836:Atg2b UTSW 12 105646814 missense probably benign
R5007:Atg2b UTSW 12 105643876 splice site probably null
R5042:Atg2b UTSW 12 105621262 missense probably benign 0.01
R5134:Atg2b UTSW 12 105674950 missense probably damaging 0.96
R5212:Atg2b UTSW 12 105646796 missense probably benign 0.00
R5250:Atg2b UTSW 12 105635765 missense probably damaging 1.00
R5307:Atg2b UTSW 12 105658329 missense probably benign 0.17
R5342:Atg2b UTSW 12 105658916 missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105649155 missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105621328 missense probably benign 0.00
R5660:Atg2b UTSW 12 105649124 nonsense probably null
R6018:Atg2b UTSW 12 105661171 missense probably damaging 0.96
R6153:Atg2b UTSW 12 105623482 missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105661092 nonsense probably null
R6584:Atg2b UTSW 12 105657995 missense probably damaging 1.00
R6593:Atg2b UTSW 12 105644848 missense probably damaging 1.00
R6669:Atg2b UTSW 12 105671529 missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105635788 missense probably damaging 1.00
R7003:Atg2b UTSW 12 105654249 missense probably benign 0.01
R7193:Atg2b UTSW 12 105664708 missense probably damaging 1.00
R7387:Atg2b UTSW 12 105622775 missense probably damaging 1.00
R7432:Atg2b UTSW 12 105661204 missense probably damaging 0.98
R7432:Atg2b UTSW 12 105664698 missense probably benign 0.08
R7630:Atg2b UTSW 12 105646954 critical splice acceptor site probably null
R7634:Atg2b UTSW 12 105652120 missense probably damaging 1.00
R7645:Atg2b UTSW 12 105623430 missense probably benign 0.06
R7653:Atg2b UTSW 12 105636472 missense possibly damaging 0.68
X0018:Atg2b UTSW 12 105666697 missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105646785 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCAAATGCCCTTGGTCCAC -3'
(R):5'- TCCCAGAGCTGTGGTAAGAAGTAG -3'

Sequencing Primer
(F):5'- AAATGCCCTTGGTCCACTTAATTTG -3'
(R):5'- CTGTGGTAAGAAGTAGAGAAGGTTTG -3'
Posted On2017-02-15