Incidental Mutation 'R5903:Atg2b'
ID 456462
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Name autophagy related 2B
Synonyms C030004M05Rik, 2410024A21Rik, C630028L02Rik
MMRRC Submission 044101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R5903 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 105582395-105651470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105605618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1449 (D1449G)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
AlphaFold Q80XK6
Predicted Effect possibly damaging
Transcript: ENSMUST00000041055
AA Change: D1449G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: D1449G

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221015
AA Change: D288G
Meta Mutation Damage Score 0.1227 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 66,145,661 (GRCm39) V150A unknown Het
Abraxas1 T C 5: 100,965,824 (GRCm39) probably null Het
Actl7a G T 4: 56,743,827 (GRCm39) R118L probably damaging Het
Atg7 G A 6: 114,683,254 (GRCm39) W439* probably null Het
Atp6v0a2 T A 5: 124,789,343 (GRCm39) I370N probably damaging Het
B4galt1 T C 4: 40,807,760 (GRCm39) D347G probably damaging Het
Baz2b C T 2: 59,790,233 (GRCm39) C660Y probably damaging Het
Ccdc88c T C 12: 100,896,801 (GRCm39) Y1390C probably damaging Het
Cdcp1 G A 9: 123,002,837 (GRCm39) Q745* probably null Het
Cep97 G A 16: 55,739,889 (GRCm39) S185L probably damaging Het
Clec4d A G 6: 123,244,020 (GRCm39) H43R probably damaging Het
Cntn3 T A 6: 102,219,094 (GRCm39) M509L probably benign Het
Cntrob A C 11: 69,200,201 (GRCm39) S564R possibly damaging Het
Cyp2j8 T A 4: 96,395,514 (GRCm39) N37I possibly damaging Het
Edc4 A G 8: 106,617,219 (GRCm39) T1029A probably benign Het
Fhip2b A T 14: 70,829,121 (GRCm39) V64E probably damaging Het
Fmnl1 G T 11: 103,062,270 (GRCm39) probably null Het
Fzd6 T A 15: 38,870,783 (GRCm39) M1K probably null Het
Gle1 C A 2: 29,830,293 (GRCm39) T283N probably benign Het
Hsd17b14 T C 7: 45,215,386 (GRCm39) V161A probably damaging Het
Hsf2 T C 10: 57,380,819 (GRCm39) S218P probably benign Het
Ipo7 T A 7: 109,650,020 (GRCm39) C736S probably damaging Het
Itpkb G T 1: 180,241,540 (GRCm39) V737L probably damaging Het
Itpr1 T C 6: 108,466,758 (GRCm39) probably benign Het
Kcnh8 G T 17: 53,110,364 (GRCm39) V192L possibly damaging Het
Kctd10 G A 5: 114,518,523 (GRCm39) probably benign Het
Kdm3a C A 6: 71,609,234 (GRCm39) probably benign Het
Kif5a T A 10: 127,066,447 (GRCm39) M990L probably benign Het
Klf12 A G 14: 100,260,124 (GRCm39) S202P probably damaging Het
Krt81 T G 15: 101,358,083 (GRCm39) Q390P probably damaging Het
Lrig3 T C 10: 125,844,347 (GRCm39) S604P probably damaging Het
Ms4a1 A T 19: 11,235,612 (GRCm39) V48D probably damaging Het
Mta1 C T 12: 113,100,239 (GRCm39) P688L probably damaging Het
Oas1h T C 5: 121,009,040 (GRCm39) V250A probably damaging Het
Or10c1 A T 17: 37,521,912 (GRCm39) Y277* probably null Het
Or52z13 G T 7: 103,247,128 (GRCm39) G202* probably null Het
P2rx3 T C 2: 84,831,071 (GRCm39) E265G possibly damaging Het
Pdzd8 A G 19: 59,333,718 (GRCm39) I101T possibly damaging Het
Psme4 A T 11: 30,791,589 (GRCm39) N1148I probably benign Het
Rnf213 T C 11: 119,312,195 (GRCm39) L874P probably damaging Het
Sart3 T C 5: 113,889,300 (GRCm39) Y508C probably damaging Het
Sez6l2 T C 7: 126,569,305 (GRCm39) probably benign Het
Slc9b1 C T 3: 135,098,655 (GRCm39) probably benign Het
Stmn3 T C 2: 180,950,573 (GRCm39) K78E possibly damaging Het
Thsd4 T A 9: 60,301,389 (GRCm39) N302I possibly damaging Het
Trdv5 A T 14: 54,386,242 (GRCm39) H74Q probably benign Het
Tubb4b C T 2: 25,113,993 (GRCm39) R77H probably benign Het
Ugt1a6a C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Unc5a T A 13: 55,147,503 (GRCm39) C438S possibly damaging Het
Zan C A 5: 137,440,396 (GRCm39) C1946F unknown Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105,611,175 (GRCm39) missense probably benign 0.20
IGL01326:Atg2b APN 12 105,588,403 (GRCm39) missense probably damaging 1.00
IGL02063:Atg2b APN 12 105,614,581 (GRCm39) missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105,602,699 (GRCm39) splice site probably benign
IGL02376:Atg2b APN 12 105,611,727 (GRCm39) missense probably damaging 1.00
IGL02381:Atg2b APN 12 105,614,607 (GRCm39) missense probably damaging 1.00
IGL02434:Atg2b APN 12 105,605,466 (GRCm39) missense probably benign 0.00
IGL02534:Atg2b APN 12 105,609,526 (GRCm39) missense probably damaging 1.00
IGL03011:Atg2b APN 12 105,592,621 (GRCm39) missense probably damaging 0.98
IGL03173:Atg2b APN 12 105,624,553 (GRCm39) missense possibly damaging 0.68
R6669_atg2b_067 UTSW 12 105,637,788 (GRCm39) missense possibly damaging 0.90
rail UTSW 12 105,625,099 (GRCm39) nonsense probably null
Sora UTSW 12 105,589,689 (GRCm39) missense probably benign 0.06
R0066:Atg2b UTSW 12 105,614,708 (GRCm39) missense probably benign
R0066:Atg2b UTSW 12 105,614,708 (GRCm39) missense probably benign
R0511:Atg2b UTSW 12 105,583,412 (GRCm39) missense probably damaging 1.00
R0762:Atg2b UTSW 12 105,641,229 (GRCm39) missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105,602,767 (GRCm39) missense probably benign 0.00
R1029:Atg2b UTSW 12 105,602,032 (GRCm39) missense probably damaging 0.96
R1529:Atg2b UTSW 12 105,627,392 (GRCm39) missense probably benign
R1563:Atg2b UTSW 12 105,589,747 (GRCm39) missense probably damaging 0.99
R1746:Atg2b UTSW 12 105,635,588 (GRCm39) missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105,620,351 (GRCm39) missense probably benign 0.01
R1956:Atg2b UTSW 12 105,635,677 (GRCm39) missense probably damaging 1.00
R1957:Atg2b UTSW 12 105,635,677 (GRCm39) missense probably damaging 1.00
R2272:Atg2b UTSW 12 105,604,267 (GRCm39) missense probably benign 0.00
R2877:Atg2b UTSW 12 105,630,268 (GRCm39) nonsense probably null
R2878:Atg2b UTSW 12 105,630,268 (GRCm39) nonsense probably null
R4798:Atg2b UTSW 12 105,618,888 (GRCm39) missense probably benign 0.37
R4836:Atg2b UTSW 12 105,613,073 (GRCm39) missense probably benign
R5007:Atg2b UTSW 12 105,610,135 (GRCm39) splice site probably null
R5042:Atg2b UTSW 12 105,587,521 (GRCm39) missense probably benign 0.01
R5134:Atg2b UTSW 12 105,641,209 (GRCm39) missense probably damaging 0.96
R5212:Atg2b UTSW 12 105,613,055 (GRCm39) missense probably benign 0.00
R5250:Atg2b UTSW 12 105,602,024 (GRCm39) missense probably damaging 1.00
R5307:Atg2b UTSW 12 105,624,588 (GRCm39) missense probably benign 0.17
R5342:Atg2b UTSW 12 105,625,175 (GRCm39) missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105,615,414 (GRCm39) missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105,587,587 (GRCm39) missense probably benign 0.00
R5660:Atg2b UTSW 12 105,615,383 (GRCm39) nonsense probably null
R6018:Atg2b UTSW 12 105,627,430 (GRCm39) missense probably damaging 0.96
R6153:Atg2b UTSW 12 105,589,741 (GRCm39) missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105,627,351 (GRCm39) nonsense probably null
R6584:Atg2b UTSW 12 105,624,254 (GRCm39) missense probably damaging 1.00
R6593:Atg2b UTSW 12 105,611,107 (GRCm39) missense probably damaging 1.00
R6669:Atg2b UTSW 12 105,637,788 (GRCm39) missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105,602,047 (GRCm39) missense probably damaging 1.00
R7003:Atg2b UTSW 12 105,620,508 (GRCm39) missense probably benign 0.01
R7193:Atg2b UTSW 12 105,630,967 (GRCm39) missense probably damaging 1.00
R7387:Atg2b UTSW 12 105,589,034 (GRCm39) missense probably damaging 1.00
R7432:Atg2b UTSW 12 105,630,957 (GRCm39) missense probably benign 0.08
R7432:Atg2b UTSW 12 105,627,463 (GRCm39) missense probably damaging 0.98
R7630:Atg2b UTSW 12 105,613,213 (GRCm39) critical splice acceptor site probably null
R7634:Atg2b UTSW 12 105,618,379 (GRCm39) missense probably damaging 1.00
R7645:Atg2b UTSW 12 105,589,689 (GRCm39) missense probably benign 0.06
R7653:Atg2b UTSW 12 105,602,731 (GRCm39) missense possibly damaging 0.68
R8157:Atg2b UTSW 12 105,629,199 (GRCm39) missense probably damaging 1.00
R8222:Atg2b UTSW 12 105,618,475 (GRCm39) missense possibly damaging 0.95
R8469:Atg2b UTSW 12 105,604,170 (GRCm39) missense probably benign 0.00
R8708:Atg2b UTSW 12 105,635,687 (GRCm39) critical splice acceptor site probably benign
R8784:Atg2b UTSW 12 105,605,500 (GRCm39) missense probably damaging 1.00
R8975:Atg2b UTSW 12 105,602,725 (GRCm39) missense probably damaging 1.00
R8988:Atg2b UTSW 12 105,583,388 (GRCm39) missense probably damaging 0.97
R9071:Atg2b UTSW 12 105,625,099 (GRCm39) nonsense probably null
R9269:Atg2b UTSW 12 105,618,359 (GRCm39) missense probably damaging 1.00
R9355:Atg2b UTSW 12 105,636,980 (GRCm39) missense possibly damaging 0.48
R9402:Atg2b UTSW 12 105,614,682 (GRCm39) missense probably damaging 0.98
R9492:Atg2b UTSW 12 105,624,549 (GRCm39) missense probably benign 0.06
R9709:Atg2b UTSW 12 105,611,140 (GRCm39) missense probably damaging 1.00
R9717:Atg2b UTSW 12 105,605,561 (GRCm39) missense probably benign
R9746:Atg2b UTSW 12 105,630,197 (GRCm39) missense possibly damaging 0.84
X0018:Atg2b UTSW 12 105,632,956 (GRCm39) missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105,613,044 (GRCm39) missense probably benign 0.12
Z1177:Atg2b UTSW 12 105,602,023 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAAATGCCCTTGGTCCAC -3'
(R):5'- TCCCAGAGCTGTGGTAAGAAGTAG -3'

Sequencing Primer
(F):5'- AAATGCCCTTGGTCCACTTAATTTG -3'
(R):5'- CTGTGGTAAGAAGTAGAGAAGGTTTG -3'
Posted On 2017-02-15