Mutagenetix > Incidental Mutation

Incidental Mutation 'R5903:Mta1'

456463

Institutional Source

Beutler Lab

Gene Symbol

Mta1

Ensembl Gene

ENSMUSG00000021144

Gene Name

metastasis associated 1

Synonyms

MMRRC Submission

044101-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113098278-113137206 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 113136619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 688 (P688L)

Ref Sequence

ENSEMBL: ENSMUSP00000105349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]

AlphaFold

Q8K4B0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009099
AA Change: P700L

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: P700L

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069690
AA Change: P683L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: P683L

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084882

SMART Domains

Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

Domain	Start	End	E-Value	Type
LIM	4	56	2.08e-12	SMART
low complexity region	104	115	N/A	INTRINSIC
LIM	125	177	6.05e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109723
AA Change: P688L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: P688L

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109726
AA Change: P683L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: P683L

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109727
AA Change: P688L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: P688L

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156030

Predicted Effect

probably benign
Transcript: ENSMUST00000200380

SMART Domains

Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

Domain	Start	End	E-Value	Type
LIM	1	53	3e-16	SMART

Meta Mutation Damage Score

0.0761

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Mta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02227:Mta1	APN	12	113120908	missense	possibly damaging	0.94
IGL02250:Mta1	APN	12	113126798	missense	possibly damaging	0.59
IGL02391:Mta1	APN	12	113136583	missense	possibly damaging	0.79
IGL02670:Mta1	APN	12	113130121	missense	probably damaging	1.00
PIT4382001:Mta1	UTSW	12	113133250	missense	probably benign	0.06
R0361:Mta1	UTSW	12	113133341	splice site	probably null
R0496:Mta1	UTSW	12	113131321	nonsense	probably null
R1774:Mta1	UTSW	12	113128039	missense	probably damaging	1.00
R1870:Mta1	UTSW	12	113128074	missense	possibly damaging	0.73
R1976:Mta1	UTSW	12	113136306	missense	probably damaging	0.97
R2110:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2111:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2184:Mta1	UTSW	12	113130195	critical splice donor site	probably null
R2274:Mta1	UTSW	12	113128150	missense	probably damaging	1.00
R4087:Mta1	UTSW	12	113112182	missense	probably damaging	1.00
R4231:Mta1	UTSW	12	113135827	missense	possibly damaging	0.95
R4916:Mta1	UTSW	12	113136540	missense	probably benign	0.17
R5032:Mta1	UTSW	12	113133525	splice site	probably null
R5271:Mta1	UTSW	12	113131957	missense	probably damaging	0.99
R5344:Mta1	UTSW	12	113131566	splice site	probably benign
R5392:Mta1	UTSW	12	113133236	missense	probably benign
R5656:Mta1	UTSW	12	113123139	missense	probably damaging	1.00
R6168:Mta1	UTSW	12	113123119	missense	probably damaging	0.96
R7091:Mta1	UTSW	12	113136402	missense	probably damaging	1.00
R7334:Mta1	UTSW	12	113126798	missense	possibly damaging	0.59
R7408:Mta1	UTSW	12	113131468	critical splice donor site	probably null
R7889:Mta1	UTSW	12	113131688	missense	probably benign	0.02
R8136:Mta1	UTSW	12	113131678	missense	probably damaging	1.00
R8176:Mta1	UTSW	12	113120836	missense	probably benign	0.00
R8385:Mta1	UTSW	12	113131465	missense	probably benign
R8398:Mta1	UTSW	12	113131622	missense	possibly damaging	0.83
R9132:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9159:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9418:Mta1	UTSW	12	113131367	missense	probably damaging	1.00
R9489:Mta1	UTSW	12	113131465	missense	probably benign
R9596:Mta1	UTSW	12	113126850	missense	probably damaging	0.99
R9682:Mta1	UTSW	12	113131764	critical splice donor site	probably null
Z1088:Mta1	UTSW	12	113133200	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TTTTACATGGCCACCGAAGAG -3'
(R):5'- AGTTGGGGCACTACGGAAAC -3'

Sequencing Primer
(F):5'- AAGAGACCAGGTTGGAGCCTTTTC -3'
(R):5'- CACTACGGAAACAGAGGGTG -3'

Posted On

2017-02-15