Incidental Mutation 'R5903:Mta1'
ID456463
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113136619 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 688 (P688L)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009099
AA Change: P700L

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: P700L

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: P683L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: P683L

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084882
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: P688L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: P688L

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: P683L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: P683L

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: P688L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: P688L

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Predicted Effect probably benign
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 intron probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTTACATGGCCACCGAAGAG -3'
(R):5'- AGTTGGGGCACTACGGAAAC -3'

Sequencing Primer
(F):5'- AAGAGACCAGGTTGGAGCCTTTTC -3'
(R):5'- CACTACGGAAACAGAGGGTG -3'
Posted On2017-02-15