Mutagenetix > Incidental Mutation

Incidental Mutation 'R5903:Unc5a'

456464

Institutional Source

Beutler Lab

Gene Symbol

Unc5a

Ensembl Gene

ENSMUSG00000025876

Gene Name

unc-5 netrin receptor A

Synonyms

Unc5h1

MMRRC Submission

044101-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54949411-55006018 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54999690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 438 (C438S)

Ref Sequence

ENSEMBL: ENSMUSP00000026994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000109994] [ENSMUST00000136852] [ENSMUST00000137967]

AlphaFold

Q8K1S4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026994
AA Change: C438S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: C438S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SCOP:d1biha1	44	143	1e-4	SMART
IG	155	240	1.8e-5	SMART
TSP1	245	296	1.25e-14	SMART
TSP1	301	350	1.98e-8	SMART
transmembrane domain	360	382	N/A	INTRINSIC
ZU5	495	598	3.68e-58	SMART
DEATH	805	896	5.86e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109994
AA Change: C382S

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: C382S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SCOP:d1biha1	44	143	1e-4	SMART
IG	155	240	1.8e-5	SMART
TSP1	245	294	1.98e-8	SMART
transmembrane domain	305	327	N/A	INTRINSIC
ZU5	439	542	3.68e-58	SMART
DEATH	749	840	5.86e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136852
AA Change: C136S

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116585
Gene: ENSMUSG00000025876
AA Change: C136S

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
TSP1	20	70	1.23e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137967

SMART Domains

Protein: ENSMUSP00000115531
Gene: ENSMUSG00000025876

Domain	Start	End	E-Value	Type
PDB:3G5B\|A	1	118	6e-36	PDB
Blast:DEATH	80	119	9e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142906

Meta Mutation Damage Score

0.1238

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Unc5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Unc5a	APN	13	54995820	missense	probably benign	0.00
IGL00339:Unc5a	APN	13	54995815	missense	possibly damaging	0.89
IGL00924:Unc5a	APN	13	55004514	missense	probably damaging	0.99
IGL01411:Unc5a	APN	13	55002928	missense	probably damaging	1.00
IGL01511:Unc5a	APN	13	55004816	missense	probably damaging	0.97
IGL02430:Unc5a	APN	13	55002482	missense	probably damaging	1.00
IGL02996:Unc5a	APN	13	54996178	missense	probably damaging	0.99
IGL03188:Unc5a	APN	13	54999503	missense	probably damaging	0.98
PIT1430001:Unc5a	UTSW	13	55003896	missense	probably damaging	1.00
PIT4378001:Unc5a	UTSW	13	54995868	missense	possibly damaging	0.95
R0009:Unc5a	UTSW	13	55002879	missense	probably damaging	1.00
R0009:Unc5a	UTSW	13	55002879	missense	probably damaging	1.00
R0028:Unc5a	UTSW	13	55003913	missense	possibly damaging	0.70
R0505:Unc5a	UTSW	13	55004954	missense	probably damaging	1.00
R0744:Unc5a	UTSW	13	55003933	missense	possibly damaging	0.92
R0745:Unc5a	UTSW	13	55005255	frame shift	probably null
R0836:Unc5a	UTSW	13	55003933	missense	possibly damaging	0.92
R1018:Unc5a	UTSW	13	54990952	missense	possibly damaging	0.81
R1432:Unc5a	UTSW	13	55004472	unclassified	probably benign
R1469:Unc5a	UTSW	13	54996419	missense	probably damaging	1.00
R1469:Unc5a	UTSW	13	54996419	missense	probably damaging	1.00
R1691:Unc5a	UTSW	13	55002924	missense	probably damaging	1.00
R2132:Unc5a	UTSW	13	54991083	missense	probably damaging	0.96
R4020:Unc5a	UTSW	13	55003369	missense	probably damaging	1.00
R4080:Unc5a	UTSW	13	55004481	missense	possibly damaging	0.62
R4720:Unc5a	UTSW	13	55003883	missense	probably null	1.00
R4876:Unc5a	UTSW	13	54997229	missense	probably benign
R4953:Unc5a	UTSW	13	54999870	missense	probably benign	0.02
R5112:Unc5a	UTSW	13	55003418	critical splice donor site	probably null
R5593:Unc5a	UTSW	13	55004934	missense	possibly damaging	0.91
R6521:Unc5a	UTSW	13	55004935	missense	probably benign	0.01
R6723:Unc5a	UTSW	13	54995889	missense	probably benign	0.23
R7038:Unc5a	UTSW	13	55004484	missense	probably damaging	1.00
R7065:Unc5a	UTSW	13	54991083	missense	probably damaging	1.00
R7241:Unc5a	UTSW	13	54991020	missense	probably damaging	1.00
R7365:Unc5a	UTSW	13	54996573	missense	possibly damaging	0.80
R7487:Unc5a	UTSW	13	54996549	missense	probably benign	0.40
R7980:Unc5a	UTSW	13	54999506	missense	possibly damaging	0.57
R8032:Unc5a	UTSW	13	54996486	missense	possibly damaging	0.65
R8087:Unc5a	UTSW	13	54996172	missense	probably damaging	1.00
R8910:Unc5a	UTSW	13	55003588	missense	possibly damaging	0.66
R9126:Unc5a	UTSW	13	54997961	missense	possibly damaging	0.80
R9492:Unc5a	UTSW	13	55002475	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGCCTGTCAGCATCAAG -3'
(R):5'- AAGTTGAAGGTCCCATAGGCC -3'

Sequencing Primer
(F):5'- GCCCAGCAAAGCAGGTG -3'
(R):5'- AAGGTCCCATAGGCCATGTTG -3'

Posted On

2017-02-15