Incidental Mutation 'R5903:Unc5a'
ID456464
Institutional Source Beutler Lab
Gene Symbol Unc5a
Ensembl Gene ENSMUSG00000025876
Gene Nameunc-5 netrin receptor A
SynonymsUnc5h1
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54949411-55006018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54999690 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 438 (C438S)
Ref Sequence ENSEMBL: ENSMUSP00000026994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000109994] [ENSMUST00000136852] [ENSMUST00000137967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026994
AA Change: C438S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: C438S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109994
AA Change: C382S

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: C382S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136852
AA Change: C136S

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116585
Gene: ENSMUSG00000025876
AA Change: C136S

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
TSP1 20 70 1.23e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137967
SMART Domains Protein: ENSMUSP00000115531
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
PDB:3G5B|A 1 118 6e-36 PDB
Blast:DEATH 80 119 9e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142906
Meta Mutation Damage Score 0.1238 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Unc5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Unc5a APN 13 54995820 missense probably benign 0.00
IGL00339:Unc5a APN 13 54995815 missense possibly damaging 0.89
IGL00924:Unc5a APN 13 55004514 missense probably damaging 0.99
IGL01411:Unc5a APN 13 55002928 missense probably damaging 1.00
IGL01511:Unc5a APN 13 55004816 missense probably damaging 0.97
IGL02430:Unc5a APN 13 55002482 missense probably damaging 1.00
IGL02996:Unc5a APN 13 54996178 missense probably damaging 0.99
IGL03188:Unc5a APN 13 54999503 missense probably damaging 0.98
PIT1430001:Unc5a UTSW 13 55003896 missense probably damaging 1.00
PIT4378001:Unc5a UTSW 13 54995868 missense possibly damaging 0.95
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0009:Unc5a UTSW 13 55002879 missense probably damaging 1.00
R0028:Unc5a UTSW 13 55003913 missense possibly damaging 0.70
R0505:Unc5a UTSW 13 55004954 missense probably damaging 1.00
R0744:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R0745:Unc5a UTSW 13 55005255 frame shift probably null
R0836:Unc5a UTSW 13 55003933 missense possibly damaging 0.92
R1018:Unc5a UTSW 13 54990952 missense possibly damaging 0.81
R1432:Unc5a UTSW 13 55004472 unclassified probably benign
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1469:Unc5a UTSW 13 54996419 missense probably damaging 1.00
R1691:Unc5a UTSW 13 55002924 missense probably damaging 1.00
R2132:Unc5a UTSW 13 54991083 missense probably damaging 0.96
R4020:Unc5a UTSW 13 55003369 missense probably damaging 1.00
R4080:Unc5a UTSW 13 55004481 missense possibly damaging 0.62
R4720:Unc5a UTSW 13 55003883 missense probably null 1.00
R4876:Unc5a UTSW 13 54997229 missense probably benign
R4953:Unc5a UTSW 13 54999870 missense probably benign 0.02
R5112:Unc5a UTSW 13 55003418 critical splice donor site probably null
R5593:Unc5a UTSW 13 55004934 missense possibly damaging 0.91
R6521:Unc5a UTSW 13 55004935 missense probably benign 0.01
R6723:Unc5a UTSW 13 54995889 missense probably benign 0.23
R7038:Unc5a UTSW 13 55004484 missense probably damaging 1.00
R7065:Unc5a UTSW 13 54991083 missense probably damaging 1.00
R7241:Unc5a UTSW 13 54991020 missense probably damaging 1.00
R7365:Unc5a UTSW 13 54996573 missense possibly damaging 0.80
R7487:Unc5a UTSW 13 54996549 missense probably benign 0.40
R8032:Unc5a UTSW 13 54996486 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCCAGCCTGTCAGCATCAAG -3'
(R):5'- AAGTTGAAGGTCCCATAGGCC -3'

Sequencing Primer
(F):5'- GCCCAGCAAAGCAGGTG -3'
(R):5'- AAGGTCCCATAGGCCATGTTG -3'
Posted On2017-02-15