Incidental Mutation 'R5903:Klf12'
ID 456467
Institutional Source Beutler Lab
Gene Symbol Klf12
Ensembl Gene ENSMUSG00000072294
Gene Name Kruppel-like factor 12
Synonyms 2700063E05Rik, D530033K05Rik, AP-2rep, B130052C06Rik
MMRRC Submission 044101-MU
Accession Numbers

Ncbi RefSeq: NM_010636.3; MGI:1333796
Essential gene? Possibly non essential (E-score: 0.437) question?
Stock # R5903 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 99870632-100284679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100022688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 202 (S202P)
Ref Sequence ENSEMBL: ENSMUSP00000153901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097079] [ENSMUST00000226774] [ENSMUST00000228216]
AlphaFold O35738
Predicted Effect probably damaging
Transcript: ENSMUST00000097079
AA Change: S202P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094844
Gene: ENSMUSG00000072294
AA Change: S202P

DomainStartEndE-ValueType
low complexity region 89 145 N/A INTRINSIC
low complexity region 183 200 N/A INTRINSIC
ZnF_C2H2 317 341 9.58e-3 SMART
ZnF_C2H2 347 371 8.6e-5 SMART
ZnF_C2H2 377 399 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226774
Predicted Effect probably damaging
Transcript: ENSMUST00000228216
AA Change: S202P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1641 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(49) : Targeted(1) Gene trapped(48)
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Klf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Klf12 APN 14 100149757 missense probably damaging 0.99
IGL01407:Klf12 APN 14 100109858 missense possibly damaging 0.72
IGL01621:Klf12 APN 14 100023149 missense probably damaging 1.00
IGL02746:Klf12 APN 14 99900220 missense probably benign 0.17
IGL02839:Klf12 APN 14 99900239 nonsense probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0212:Klf12 UTSW 14 100022862 missense probably benign
R0577:Klf12 UTSW 14 100023149 missense probably damaging 0.99
R1980:Klf12 UTSW 14 100149726 splice site probably null
R2017:Klf12 UTSW 14 100022637 missense possibly damaging 0.87
R2282:Klf12 UTSW 14 99900145 missense probably damaging 0.96
R2317:Klf12 UTSW 14 99942067 missense probably benign 0.00
R2901:Klf12 UTSW 14 99900146 missense probably damaging 0.98
R4946:Klf12 UTSW 14 100022957 missense possibly damaging 0.53
R5386:Klf12 UTSW 14 99900159 missense probably damaging 1.00
R5802:Klf12 UTSW 14 100022894 missense probably benign 0.33
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6753:Klf12 UTSW 14 100109776 nonsense probably null
R8801:Klf12 UTSW 14 100022736 missense probably benign 0.18
R9347:Klf12 UTSW 14 100022708 missense possibly damaging 0.82
R9455:Klf12 UTSW 14 100109790 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCAGTGCCCTATTCAATATGG -3'
(R):5'- ATCTCCAGGACCCCTTGTTG -3'

Sequencing Primer
(F):5'- GGCCAATCATATGGTCTACAAGGTTC -3'
(R):5'- AGGACCCCTTGTTGCCTCTG -3'
Posted On 2017-02-15