Mutagenetix > Incidental Mutations

Incidental Mutation 'R5903:Krt81'

456469

Institutional Source

Beutler Lab

Gene Symbol

Krt81

Ensembl Gene

ENSMUSG00000067615

Gene Name

keratin 81

Synonyms

Krt2-19

MMRRC Submission

044101-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101459061-101463751 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 101460202 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 390 (Q390P)

Ref Sequence

ENSEMBL: ENSMUSP00000056525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061185]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061185
AA Change: Q390P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056525
Gene: ENSMUSG00000067615
AA Change: Q390P

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	2	102	5.6e-15	PFAM
Filament	105	416	6.92e-148	SMART
low complexity region	424	438	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230541

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Kif5a	T	A	10: 127,230,578	M990L	probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Krt81

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Krt81	APN	15	101460278	missense	probably benign	0.01
IGL01012:Krt81	APN	15	101461019	missense	probably benign	0.05
IGL01287:Krt81	APN	15	101463388	missense	probably benign	0.00
IGL01304:Krt81	APN	15	101463388	missense	probably benign	0.00
IGL01319:Krt81	APN	15	101463388	missense	probably benign	0.00
IGL01403:Krt81	APN	15	101463388	missense	probably benign	0.00
PIT4508001:Krt81	UTSW	15	101462725	missense	probably damaging	1.00
R0083:Krt81	UTSW	15	101463465	missense	probably damaging	1.00
R0097:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0099:Krt81	UTSW	15	101463521	nonsense	probably null
R0110:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0112:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0196:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0449:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0450:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0482:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0510:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0511:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0512:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0514:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0533:Krt81	UTSW	15	101461389	missense	probably benign	0.42
R0639:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0674:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0692:Krt81	UTSW	15	101460172	missense	possibly damaging	0.91
R0737:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R1458:Krt81	UTSW	15	101460317	missense	probably benign	0.34
R1824:Krt81	UTSW	15	101460139	missense	probably damaging	0.98
R1991:Krt81	UTSW	15	101462554	missense	probably benign	0.01
R2338:Krt81	UTSW	15	101463336	missense	probably benign	0.25
R4169:Krt81	UTSW	15	101461312	missense	probably benign
R4170:Krt81	UTSW	15	101461312	missense	probably benign
R5267:Krt81	UTSW	15	101459459	missense	probably benign
R6306:Krt81	UTSW	15	101459523	missense	probably benign	0.01
R7055:Krt81	UTSW	15	101461125	missense	probably benign	0.43
R7069:Krt81	UTSW	15	101460728	missense	possibly damaging	0.75
R7191:Krt81	UTSW	15	101460229	missense	probably damaging	1.00
R7441:Krt81	UTSW	15	101461370	missense	possibly damaging	0.95
R7727:Krt81	UTSW	15	101459567	missense	probably damaging	1.00
R7728:Krt81	UTSW	15	101460206	missense	probably damaging	1.00
R7733:Krt81	UTSW	15	101463514	missense	probably damaging	0.96
R8460:Krt81	UTSW	15	101463612	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCCTCAAAGGGACCAATGG -3'
(R):5'- TTGGGAAAGATTGGATAGCATGCTG -3'

Sequencing Primer
(F):5'- ATGGAAGATTTGCCCTCCAG -3'
(R):5'- AGGGACCCTTGGCTATCTC -3'

Posted On

2017-02-15