Incidental Mutation 'R5903:Cep97'
ID456470
Institutional Source Beutler Lab
Gene Symbol Cep97
Ensembl Gene ENSMUSG00000022604
Gene Namecentrosomal protein 97
Synonyms4932439K18Rik, E130116N02Rik, Lrriq2, 2810403B08Rik
MMRRC Submission 044101-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5903 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55899888-55934855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55919526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 185 (S185L)
Ref Sequence ENSEMBL: ENSMUSP00000112663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023270] [ENSMUST00000117468] [ENSMUST00000118500] [ENSMUST00000121129] [ENSMUST00000122280]
Predicted Effect probably benign
Transcript: ENSMUST00000023270
AA Change: S257L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023270
Gene: ENSMUSG00000022604
AA Change: S257L

DomainStartEndE-ValueType
Pfam:LRR_9 98 259 1.8e-12 PFAM
IQ 549 571 2e-1 SMART
coiled coil region 576 609 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117468
AA Change: S185L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112687
Gene: ENSMUSG00000022604
AA Change: S185L

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118500
AA Change: S185L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112663
Gene: ENSMUSG00000022604
AA Change: S185L

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121129
SMART Domains Protein: ENSMUSP00000112502
Gene: ENSMUSG00000022604

DomainStartEndE-ValueType
Pfam:LRR_6 79 103 2.8e-2 PFAM
Pfam:LRR_4 80 122 4.4e-8 PFAM
Pfam:LRR_8 80 136 7.2e-10 PFAM
Pfam:LRR_8 102 152 8.5e-8 PFAM
Pfam:LRR_1 103 123 5.2e-2 PFAM
Pfam:LRR_6 123 153 5.6e-4 PFAM
Pfam:LRR_7 124 143 1.4e-1 PFAM
Pfam:LRR_1 125 148 1.2e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122280
SMART Domains Protein: ENSMUSP00000113009
Gene: ENSMUSG00000022604

DomainStartEndE-ValueType
Pfam:LRR_6 79 103 2.7e-2 PFAM
Pfam:LRR_4 80 122 4.4e-8 PFAM
Pfam:LRR_8 94 136 4.5e-8 PFAM
Pfam:LRR_1 103 123 5.2e-2 PFAM
Pfam:LRR_6 123 147 8.1e-4 PFAM
Pfam:LRR_7 124 142 1.5e-1 PFAM
Pfam:LRR_1 125 152 1.1e-3 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Cep97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Cep97 APN 16 55924960 splice site probably benign
IGL01142:Cep97 APN 16 55922198 missense probably damaging 1.00
IGL01383:Cep97 APN 16 55911607 missense probably damaging 1.00
IGL01529:Cep97 APN 16 55930618 splice site probably benign
IGL01693:Cep97 APN 16 55930594 missense probably damaging 1.00
IGL01759:Cep97 APN 16 55930573 missense probably damaging 1.00
IGL02085:Cep97 APN 16 55915505 missense probably damaging 1.00
IGL02135:Cep97 APN 16 55922967 missense probably damaging 1.00
IGL02582:Cep97 APN 16 55922176 missense probably damaging 1.00
IGL02631:Cep97 APN 16 55922178 nonsense probably null
IGL02899:Cep97 APN 16 55918540 missense probably damaging 0.98
IGL03086:Cep97 APN 16 55915296 missense probably benign
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0309:Cep97 UTSW 16 55925058 missense probably damaging 0.96
R0504:Cep97 UTSW 16 55905779 missense probably benign 0.00
R0507:Cep97 UTSW 16 55905882 splice site probably benign
R0508:Cep97 UTSW 16 55930606 missense probably benign 0.02
R0658:Cep97 UTSW 16 55914902 missense probably benign 0.09
R1588:Cep97 UTSW 16 55927821 missense probably damaging 1.00
R1619:Cep97 UTSW 16 55927796 missense probably damaging 1.00
R1710:Cep97 UTSW 16 55915022 missense probably damaging 0.99
R1872:Cep97 UTSW 16 55927866 missense probably damaging 1.00
R1878:Cep97 UTSW 16 55905226 missense probably damaging 1.00
R1896:Cep97 UTSW 16 55927744 missense probably damaging 1.00
R5401:Cep97 UTSW 16 55924952 missense probably benign 0.03
R5520:Cep97 UTSW 16 55915296 missense probably benign
R5627:Cep97 UTSW 16 55924967 critical splice donor site probably null
R5632:Cep97 UTSW 16 55915583 missense probably benign 0.02
R5914:Cep97 UTSW 16 55905457 missense probably benign 0.02
R6185:Cep97 UTSW 16 55915092 missense probably benign
R6381:Cep97 UTSW 16 55922171 missense probably damaging 1.00
R7041:Cep97 UTSW 16 55905754 missense probably benign
R7056:Cep97 UTSW 16 55905572 missense probably damaging 1.00
R7371:Cep97 UTSW 16 55905320 missense probably benign 0.00
R7862:Cep97 UTSW 16 55905721 missense probably benign 0.26
R7945:Cep97 UTSW 16 55905721 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCTACAGGGAAGTCACCAAC -3'
(R):5'- GAGCGCTTGCACTATCTCTC -3'

Sequencing Primer
(F):5'- GGGAAGTCACCAACAAAGCTCTC -3'
(R):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
Posted On2017-02-15