Incidental Mutation 'R5905:Hgfac'
ID456499
Institutional Source Beutler Lab
Gene Symbol Hgfac
Ensembl Gene ENSMUSG00000029102
Gene Namehepatocyte growth factor activator
SynonymsHGFA
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5905 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35041509-35048461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35042362 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 63 (N63D)
Ref Sequence ENSEMBL: ENSMUSP00000030985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000087684] [ENSMUST00000114283] [ENSMUST00000114285] [ENSMUST00000202573]
Predicted Effect probably benign
Transcript: ENSMUST00000030985
AA Change: N63D

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102
AA Change: N63D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087684
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114283
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114285
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150139
SMART Domains Protein: ENSMUSP00000117158
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Blast:RBD 2 33 5e-13 BLAST
Pfam:RGS12_us2 35 80 5.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202168
Predicted Effect probably benign
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202921
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that proteolytically activates hepatocyte growth factor (HGF) and plays a vital role in the regulation of HGF activity in the regeneration and repair of various tissues. The encoded protein is an inactive zymogen that is proteolytically activated to generate a heterodimeric enzyme consisting of a short chain and a long chain linked by a disulfide bridge. Mice lacking the encoded protein display an impairment in mucosal regeneration after injury. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display impaired intestinal regeneration and increased mortality after intestinal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Hgfac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hgfac APN 5 35046526 missense probably damaging 1.00
IGL01999:Hgfac APN 5 35044811 missense probably benign
IGL02133:Hgfac APN 5 35046587 missense probably damaging 1.00
IGL02314:Hgfac APN 5 35041597 start codon destroyed probably benign 0.21
IGL02337:Hgfac APN 5 35042378 missense probably benign 0.00
IGL02405:Hgfac APN 5 35044480 missense probably benign 0.19
IGL02451:Hgfac APN 5 35043814 splice site probably null
IGL02508:Hgfac APN 5 35047220 missense probably damaging 1.00
IGL02584:Hgfac APN 5 35043961 unclassified probably benign
IGL02986:Hgfac APN 5 35043863 missense probably benign 0.00
R0506:Hgfac UTSW 5 35044240 missense probably damaging 1.00
R0664:Hgfac UTSW 5 35048178 missense probably benign 0.34
R1733:Hgfac UTSW 5 35043674 missense probably damaging 1.00
R1775:Hgfac UTSW 5 35042850 unclassified probably benign
R1871:Hgfac UTSW 5 35042913 makesense probably null
R3826:Hgfac UTSW 5 35048162 missense probably damaging 1.00
R4553:Hgfac UTSW 5 35042856 missense probably damaging 0.97
R5888:Hgfac UTSW 5 35045407 missense probably damaging 1.00
R6017:Hgfac UTSW 5 35044395 missense probably damaging 1.00
R6056:Hgfac UTSW 5 35041629 nonsense probably null
R6124:Hgfac UTSW 5 35044384 missense probably benign 0.06
R7059:Hgfac UTSW 5 35044429 missense possibly damaging 0.49
R7232:Hgfac UTSW 5 35046914 missense probably damaging 1.00
R7555:Hgfac UTSW 5 35042628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGGAGTCTCAGGTCTCTGG -3'
(R):5'- TTCCCTCAGAGGTACAGGAGTG -3'

Sequencing Primer
(F):5'- CAGGTCTCTGGTGTATCCGAC -3'
(R):5'- ATCAGGCATCCCACTGGGTAC -3'
Posted On2017-02-15