Incidental Mutation 'R5905:Lmod3'
ID456506
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Nameleiomodin 3 (fetal)
Synonyms5430424A14Rik
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5905 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location97238534-97252759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97247614 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 415 (E415D)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
Predicted Effect probably damaging
Transcript: ENSMUST00000095655
AA Change: E415D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: E415D

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97252297 missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97247861 missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97252552 missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97247672 missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97238835 utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97247195 missense possibly damaging 0.92
Runted UTSW 6 97247273 missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97247345 missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97248071 missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97247877 missense probably benign 0.06
R4038:Lmod3 UTSW 6 97248314 missense probably benign 0.06
R4913:Lmod3 UTSW 6 97247164 splice site probably null
R5867:Lmod3 UTSW 6 97248002 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97252553 missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97247301 missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97247378 missense probably benign 0.00
R7225:Lmod3 UTSW 6 97247384 missense probably benign 0.34
R7531:Lmod3 UTSW 6 97248442 missense probably benign 0.01
R7908:Lmod3 UTSW 6 97248473 missense probably benign 0.05
R8022:Lmod3 UTSW 6 97248299 missense probably benign
R8154:Lmod3 UTSW 6 97247980 missense probably damaging 1.00
R8325:Lmod3 UTSW 6 97247418 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCCTTTCTTGAACCAAAGGGG -3'
(R):5'- CCTCCAGTTCAATGAAACGC -3'

Sequencing Primer
(F):5'- AGGGGACTTCCTGAGCATC -3'
(R):5'- TGAAACGCTAACTGAACTTCGG -3'
Posted On2017-02-15