Incidental Mutation 'R5905:Nlrp9a'
ID456511
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene NameNLR family, pyrin domain containing 9A
SynonymsNalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5905 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26535023-26575615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26558337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 460 (T460I)
Ref Sequence ENSEMBL: ENSMUSP00000112398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040] [ENSMUST00000153452]
Predicted Effect probably benign
Transcript: ENSMUST00000071780
AA Change: T460I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102
AA Change: T460I

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108387
AA Change: T460I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102
AA Change: T460I

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117252
AA Change: T460I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102
AA Change: T460I

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122040
AA Change: T460I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102
AA Change: T460I

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143149
Predicted Effect probably benign
Transcript: ENSMUST00000153452
AA Change: T371I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120498
Gene: ENSMUSG00000054102
AA Change: T371I

DomainStartEndE-ValueType
Pfam:NACHT 54 222 6.9e-33 PFAM
LRR 542 569 1.42e0 SMART
LRR 603 630 1.42e0 SMART
Blast:LRR 632 657 1e-5 BLAST
LRR 659 686 2.32e-1 SMART
LRR 688 715 3e0 SMART
LRR 716 743 1.12e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26557625 missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26558678 missense probably benign
IGL01081:Nlrp9a APN 7 26558094 missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26557581 missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26557874 missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26557264 missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26558019 missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26557893 missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26564971 missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26564956 missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26558651 missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26557457 missense probably damaging 1.00
R0005:Nlrp9a UTSW 7 26573788 splice site probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0013:Nlrp9a UTSW 7 26571225 splice site probably null
R0086:Nlrp9a UTSW 7 26558547 missense probably damaging 0.98
R0659:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R1126:Nlrp9a UTSW 7 26560741 missense probably benign 0.12
R1500:Nlrp9a UTSW 7 26567891 missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26558668 missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26570507 nonsense probably null
R1968:Nlrp9a UTSW 7 26564941 missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26573913 missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2059:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26564929 missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26573852 missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26571385 nonsense probably null
R3545:Nlrp9a UTSW 7 26557332 missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26564852 nonsense probably null
R4005:Nlrp9a UTSW 7 26558550 missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26570646 missense probably benign 0.00
R4529:Nlrp9a UTSW 7 26571407 missense probably damaging 1.00
R4756:Nlrp9a UTSW 7 26557441 missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26550944 missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26570539 missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26557386 missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26571278 missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26557292 missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26557829 missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26558568 missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26570640 missense probably damaging 1.00
R5978:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26558085 missense probably benign 0.00
R6082:Nlrp9a UTSW 7 26567977 missense probably benign 0.41
R6171:Nlrp9a UTSW 7 26558763 missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26557626 missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26550886 missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26557392 missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26567942 missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26557247 nonsense probably null
R7173:Nlrp9a UTSW 7 26558178 missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26551038 missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26558724 missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26558718 missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26571269 missense probably damaging 1.00
R7492:Nlrp9a UTSW 7 26557656 missense probably damaging 0.99
R7586:Nlrp9a UTSW 7 26557296 missense possibly damaging 0.83
R7844:Nlrp9a UTSW 7 26562581 missense possibly damaging 0.82
R8073:Nlrp9a UTSW 7 26560835 missense probably damaging 0.98
R8136:Nlrp9a UTSW 7 26557253 missense probably benign 0.34
R8400:Nlrp9a UTSW 7 26565006 missense probably benign 0.02
R8415:Nlrp9a UTSW 7 26557500 missense probably benign
Z1176:Nlrp9a UTSW 7 26558229 missense probably damaging 1.00
Z1177:Nlrp9a UTSW 7 26557456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGCTGTAGAGGGAATG -3'
(R):5'- TTGCATTCTTGTTGACTGAGAC -3'

Sequencing Primer
(F):5'- TGGAAACAGGTATATGTGTTTGACTC -3'
(R):5'- GACTGAGACTTTTGATGTATCTGATG -3'
Posted On2017-02-15