Incidental Mutation 'R5905:Syt17'
ID 456516
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission 044102-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5905 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 117979940-118047445 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118036141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 74 (D74G)
Ref Sequence ENSEMBL: ENSMUSP00000147122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
AlphaFold Q920M7
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: D75G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: D75G

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: D74G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000203485
AA Change: D79G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420
AA Change: D79G

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
AA Change: D18G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420
AA Change: D18G

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,533,718 (GRCm39) probably null Het
Acat1 A T 9: 53,503,366 (GRCm39) Y158N probably damaging Het
Adamtsl1 C A 4: 86,260,561 (GRCm39) A924E probably damaging Het
Alad G T 4: 62,428,359 (GRCm39) T305K probably benign Het
Als2cl G T 9: 110,727,152 (GRCm39) R906L probably damaging Het
Ap3d1 T C 10: 80,558,761 (GRCm39) N281S possibly damaging Het
Arf4 A G 14: 26,375,079 (GRCm39) T113A probably benign Het
Asah2 T C 19: 31,993,914 (GRCm39) D438G probably damaging Het
Cachd1 C A 4: 100,840,753 (GRCm39) N905K probably damaging Het
Catsperb T A 12: 101,568,959 (GRCm39) M877K possibly damaging Het
Cc2d2a A T 5: 43,869,768 (GRCm39) M890L probably benign Het
Cd180 A T 13: 102,842,541 (GRCm39) H529L possibly damaging Het
Cdh23 G T 10: 60,370,314 (GRCm39) D160E probably damaging Het
Chd7 C A 4: 8,840,553 (GRCm39) N1440K possibly damaging Het
Cntln T A 4: 84,889,410 (GRCm39) S298T probably benign Het
Cplx3 A G 9: 57,515,546 (GRCm39) I443T probably damaging Het
Dmap1 G T 4: 117,533,963 (GRCm39) T132K probably benign Het
Dnah11 C T 12: 117,918,659 (GRCm39) G3424E probably damaging Het
Dnah5 T A 15: 28,387,979 (GRCm39) M3146K probably damaging Het
Egfr A T 11: 16,861,494 (GRCm39) E1091V probably damaging Het
Eps8l2 T C 7: 140,937,746 (GRCm39) F422S possibly damaging Het
F2r A G 13: 95,741,121 (GRCm39) V138A possibly damaging Het
Faf1 T A 4: 109,748,126 (GRCm39) M477K probably benign Het
Fam149b C T 14: 20,409,978 (GRCm39) T235M probably benign Het
Fan1 C A 7: 64,003,399 (GRCm39) A808S probably benign Het
Fbxl20 A G 11: 98,006,271 (GRCm39) I38T probably damaging Het
Fnbp4 C A 2: 90,581,478 (GRCm39) T177K probably benign Het
Gm9747 T C 1: 82,212,019 (GRCm39) probably benign Het
Grip1 A G 10: 119,821,397 (GRCm39) D354G probably benign Het
Grk4 A C 5: 34,869,074 (GRCm39) Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Hgfac A G 5: 35,199,706 (GRCm39) N63D probably benign Het
Hk1 C A 10: 62,188,837 (GRCm39) K25N probably null Het
Hrc G A 7: 44,985,658 (GRCm39) G270S probably damaging Het
Inhba T A 13: 16,191,893 (GRCm39) W5R probably benign Het
Lipm T C 19: 34,089,311 (GRCm39) S90P probably benign Het
Lmod3 T A 6: 97,224,575 (GRCm39) E415D probably damaging Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Lrrc63 A G 14: 75,323,614 (GRCm39) S537P possibly damaging Het
Map9 T A 3: 82,287,555 (GRCm39) probably null Het
Marf1 T A 16: 13,945,113 (GRCm39) Q1252L probably damaging Het
Mc3r A T 2: 172,091,129 (GRCm39) D117V probably damaging Het
Mepce A G 5: 137,782,982 (GRCm39) V448A possibly damaging Het
Mical1 A T 10: 41,362,873 (GRCm39) M973L probably benign Het
Mmp21 T C 7: 133,280,443 (GRCm39) T176A probably benign Het
Nacc2 A G 2: 25,951,590 (GRCm39) V415A probably damaging Het
Neb G A 2: 52,083,243 (GRCm39) T1639I probably damaging Het
Nfia A G 4: 97,999,488 (GRCm39) H485R possibly damaging Het
Nlrp9a C T 7: 26,257,762 (GRCm39) T460I probably benign Het
Or10p21 A T 10: 128,847,156 (GRCm39) M1L probably benign Het
Or52z15 T A 7: 103,332,781 (GRCm39) N285K probably damaging Het
Or56b35 T C 7: 104,964,158 (GRCm39) Y316H probably benign Het
Or8g24 T A 9: 38,989,379 (GRCm39) I221F probably damaging Het
Or8k32 T A 2: 86,369,113 (GRCm39) I49F possibly damaging Het
Or9s13 T A 1: 92,547,864 (GRCm39) C79S possibly damaging Het
Otoa T A 7: 120,693,824 (GRCm39) L68Q probably damaging Het
Pclo A T 5: 14,730,399 (GRCm39) probably benign Het
Pcsk2 T A 2: 143,591,060 (GRCm39) Y186N probably damaging Het
Pigz A G 16: 31,764,246 (GRCm39) T435A probably benign Het
Pja2 T C 17: 64,616,085 (GRCm39) D270G probably benign Het
Polb G T 8: 23,130,011 (GRCm39) S187* probably null Het
Popdc3 A G 10: 45,194,015 (GRCm39) D272G probably benign Het
Prr5 A T 15: 84,626,178 (GRCm39) K84N possibly damaging Het
Prss36 T C 7: 127,532,744 (GRCm39) D716G probably benign Het
Rapgef5 T A 12: 117,712,161 (GRCm39) D547E probably damaging Het
Slc4a11 T A 2: 130,526,972 (GRCm39) I719F probably damaging Het
Smpd2 A G 10: 41,365,344 (GRCm39) W51R probably damaging Het
Snrpb T A 2: 130,021,196 (GRCm39) probably benign Het
Sox9 A G 11: 112,674,646 (GRCm39) E148G probably damaging Het
Strbp G A 2: 37,515,267 (GRCm39) T253I probably damaging Het
Sult1d1 A T 5: 87,707,685 (GRCm39) M145K probably damaging Het
Taf5l A C 8: 124,729,714 (GRCm39) probably null Het
Tas2r131 T G 6: 132,934,639 (GRCm39) I57L probably benign Het
Tcf25 A G 8: 124,108,176 (GRCm39) N77S possibly damaging Het
Tmem253 A G 14: 52,255,268 (GRCm39) T57A possibly damaging Het
Trrap A G 5: 144,786,730 (GRCm39) K3170R possibly damaging Het
Tspan17 A G 13: 54,941,111 (GRCm39) N130S probably damaging Het
Vmn1r216 C T 13: 23,283,367 (GRCm39) L17F probably damaging Het
Vmn2r3 T A 3: 64,182,698 (GRCm39) T334S probably benign Het
Wnk2 G T 13: 49,229,821 (GRCm39) A901E probably damaging Het
Zc3hav1 T C 6: 38,284,275 (GRCm39) T947A probably benign Het
Zfhx3 C T 8: 109,520,135 (GRCm39) P419L probably damaging Het
Zfp292 A G 4: 34,819,549 (GRCm39) S258P probably damaging Het
Zfp354c T C 11: 50,706,253 (GRCm39) Y274C probably damaging Het
Zfp652 G A 11: 95,640,689 (GRCm39) A205T probably benign Het
Zfp964 A G 8: 70,116,563 (GRCm39) T388A unknown Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118,033,513 (GRCm39) missense probably damaging 0.98
IGL01135:Syt17 APN 7 117,981,270 (GRCm39) missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118,007,389 (GRCm39) missense probably damaging 0.99
IGL01610:Syt17 APN 7 118,033,216 (GRCm39) missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118,009,176 (GRCm39) missense probably damaging 0.99
IGL02125:Syt17 APN 7 118,009,197 (GRCm39) missense probably benign 0.01
IGL02819:Syt17 APN 7 118,009,143 (GRCm39) splice site probably benign
H8562:Syt17 UTSW 7 118,007,292 (GRCm39) missense probably benign 0.01
R0127:Syt17 UTSW 7 118,009,164 (GRCm39) missense probably damaging 0.98
R0328:Syt17 UTSW 7 117,981,216 (GRCm39) missense probably benign 0.28
R1789:Syt17 UTSW 7 118,036,061 (GRCm39) missense probably benign 0.00
R1872:Syt17 UTSW 7 118,007,341 (GRCm39) missense probably benign 0.00
R1878:Syt17 UTSW 7 118,033,468 (GRCm39) missense probably benign 0.01
R1918:Syt17 UTSW 7 118,033,208 (GRCm39) missense possibly damaging 0.54
R2133:Syt17 UTSW 7 117,981,270 (GRCm39) missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118,033,180 (GRCm39) missense probably damaging 1.00
R4471:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4472:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4567:Syt17 UTSW 7 118,033,495 (GRCm39) missense probably benign 0.06
R5211:Syt17 UTSW 7 118,041,626 (GRCm39) missense probably benign 0.19
R6054:Syt17 UTSW 7 118,007,356 (GRCm39) missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118,033,513 (GRCm39) missense probably damaging 0.98
R6332:Syt17 UTSW 7 118,033,466 (GRCm39) missense probably benign 0.00
R7022:Syt17 UTSW 7 118,007,242 (GRCm39) missense probably benign 0.00
R7440:Syt17 UTSW 7 117,981,107 (GRCm39) missense probably damaging 1.00
R7610:Syt17 UTSW 7 118,033,682 (GRCm39) splice site probably null
R7845:Syt17 UTSW 7 118,009,194 (GRCm39) missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118,009,228 (GRCm39) missense probably damaging 0.99
R8296:Syt17 UTSW 7 118,036,069 (GRCm39) missense probably damaging 0.97
R8429:Syt17 UTSW 7 118,033,564 (GRCm39) missense probably benign
R8949:Syt17 UTSW 7 118,033,054 (GRCm39) critical splice donor site probably null
R9278:Syt17 UTSW 7 118,033,480 (GRCm39) missense probably damaging 1.00
R9622:Syt17 UTSW 7 118,036,191 (GRCm39) missense probably benign
R9629:Syt17 UTSW 7 118,007,379 (GRCm39) missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118,033,446 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGACCCTAAGCACTGATGGG -3'
(R):5'- CAGCCACTGAATGTTGCTATGG -3'

Sequencing Primer
(F):5'- CGGATTCCCAAGTGCAGAGATTTC -3'
(R):5'- GCTATGGTTCAGAAAGGTACAACTAC -3'
Posted On 2017-02-15