Incidental Mutation 'R5905:Eps8l2'
ID456520
Institutional Source Beutler Lab
Gene Symbol Eps8l2
Ensembl Gene ENSMUSG00000025504
Gene NameEPS8-like 2
Synonyms
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5905 (G1)
Quality Score224
Status Not validated
Chromosome7
Chromosomal Location141338880-141363020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141357833 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 422 (F422S)
Ref Sequence ENSEMBL: ENSMUSP00000026577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026577] [ENSMUST00000143633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026577
AA Change: F422S

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504
AA Change: F422S

DomainStartEndE-ValueType
Pfam:PTB 51 181 6.6e-50 PFAM
Pfam:PID 52 175 5.9e-9 PFAM
low complexity region 196 209 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
SH3 498 553 2.11e-15 SMART
PDB:1WWU|A 614 700 2e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140025
Predicted Effect probably benign
Transcript: ENSMUST00000143633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210158
Meta Mutation Damage Score 0.8310 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display late onset progressive hearing loss and gradual deterioration of cochlear hair cell stereocilliary bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Eps8l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Eps8l2 APN 7 141357663 missense probably benign 0.06
IGL01444:Eps8l2 APN 7 141361375 splice site probably benign
IGL01467:Eps8l2 APN 7 141361601 missense probably damaging 1.00
IGL01803:Eps8l2 APN 7 141358230 missense probably benign
IGL02598:Eps8l2 APN 7 141354936 splice site probably benign
IGL02823:Eps8l2 APN 7 141342075 missense probably damaging 1.00
IGL03061:Eps8l2 APN 7 141357235 unclassified probably benign
IGL03112:Eps8l2 APN 7 141361736 missense probably damaging 1.00
IGL03251:Eps8l2 APN 7 141342962 missense probably damaging 1.00
R0057:Eps8l2 UTSW 7 141342971 missense probably benign 0.08
R0133:Eps8l2 UTSW 7 141362207 missense unknown
R0361:Eps8l2 UTSW 7 141356199 missense probably benign 0.05
R0409:Eps8l2 UTSW 7 141342980 missense probably damaging 1.00
R0611:Eps8l2 UTSW 7 141355733 missense probably damaging 1.00
R1487:Eps8l2 UTSW 7 141361618 missense probably benign
R1679:Eps8l2 UTSW 7 141361057 missense probably damaging 1.00
R1914:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1915:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1918:Eps8l2 UTSW 7 141361724 missense probably damaging 0.99
R2098:Eps8l2 UTSW 7 141355792 splice site probably null
R2170:Eps8l2 UTSW 7 141342071 missense probably benign 0.02
R3429:Eps8l2 UTSW 7 141357919 critical splice donor site probably null
R3734:Eps8l2 UTSW 7 141357821 missense probably damaging 1.00
R4296:Eps8l2 UTSW 7 141358262 nonsense probably null
R4701:Eps8l2 UTSW 7 141357260 missense probably damaging 1.00
R4758:Eps8l2 UTSW 7 141360373 missense probably damaging 0.98
R5564:Eps8l2 UTSW 7 141356621 missense possibly damaging 0.94
R5567:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5570:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5735:Eps8l2 UTSW 7 141360377 missense probably damaging 1.00
R5893:Eps8l2 UTSW 7 141357624 missense probably damaging 1.00
R5927:Eps8l2 UTSW 7 141356346 missense probably benign
R6028:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R6248:Eps8l2 UTSW 7 141342102 missense probably damaging 0.99
R6631:Eps8l2 UTSW 7 141356202 missense probably damaging 1.00
R7152:Eps8l2 UTSW 7 141355765 missense possibly damaging 0.95
R7231:Eps8l2 UTSW 7 141360392 missense probably damaging 1.00
R8071:Eps8l2 UTSW 7 141342947 missense probably damaging 1.00
Z1177:Eps8l2 UTSW 7 141342095 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACACTGTGGGAATCACTG -3'
(R):5'- AAGGTGACCTGGCATTGTAGG -3'

Sequencing Primer
(F):5'- CTGTGGGAATCACTGGGGGAG -3'
(R):5'- GGTAGAAGACATTGTTGCTTTAGAAG -3'
Posted On2017-02-15