Incidental Mutation 'R5905:Tcf25'
ID456524
Institutional Source Beutler Lab
Gene Symbol Tcf25
Ensembl Gene ENSMUSG00000001472
Gene Nametranscription factor 25 (basic helix-loop-helix)
Synonyms1100001J13Rik, Nulp1, D8Ertd325e, 1810041K11Rik
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5905 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123373753-123403835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123381437 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 77 (N77S)
Ref Sequence ENSEMBL: ENSMUSP00000148454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057934] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212569] [ENSMUST00000212571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057934
AA Change: N77S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056485
Gene: ENSMUSG00000001472
AA Change: N77S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 248 588 4.6e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108840
AA Change: N77S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472
AA Change: N77S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000211932
AA Change: N77S

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211964
Predicted Effect possibly damaging
Transcript: ENSMUST00000212470
AA Change: N77S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212498
Predicted Effect possibly damaging
Transcript: ENSMUST00000212569
AA Change: N77S

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212571
AA Change: N77S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Tcf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Tcf25 APN 8 123393236 missense possibly damaging 0.87
IGL02638:Tcf25 APN 8 123399292 missense probably damaging 1.00
IGL03112:Tcf25 APN 8 123382519 splice site probably benign
R0492:Tcf25 UTSW 8 123381464 missense probably benign 0.00
R1081:Tcf25 UTSW 8 123381473 missense probably benign 0.00
R1543:Tcf25 UTSW 8 123388587 missense probably benign 0.01
R1634:Tcf25 UTSW 8 123397091 missense possibly damaging 0.68
R1662:Tcf25 UTSW 8 123381550 missense probably benign 0.00
R2253:Tcf25 UTSW 8 123374033 missense probably benign 0.21
R4326:Tcf25 UTSW 8 123401143 nonsense probably null
R4327:Tcf25 UTSW 8 123401143 nonsense probably null
R4667:Tcf25 UTSW 8 123397025 missense possibly damaging 0.89
R4977:Tcf25 UTSW 8 123388635 missense probably benign 0.03
R5248:Tcf25 UTSW 8 123373939 missense probably damaging 1.00
R5249:Tcf25 UTSW 8 123388633 missense probably damaging 1.00
R5759:Tcf25 UTSW 8 123381457 missense probably benign 0.00
R5806:Tcf25 UTSW 8 123381504 missense probably benign 0.09
R5813:Tcf25 UTSW 8 123395615 splice site probably null
R6028:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6114:Tcf25 UTSW 8 123384375 missense probably damaging 1.00
R6349:Tcf25 UTSW 8 123391593 missense probably damaging 1.00
R6904:Tcf25 UTSW 8 123400698 critical splice donor site probably null
R7232:Tcf25 UTSW 8 123401061 splice site probably null
R7287:Tcf25 UTSW 8 123373972 missense possibly damaging 0.74
RF007:Tcf25 UTSW 8 123395630 missense probably benign 0.03
Z1176:Tcf25 UTSW 8 123373906 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGTCCTCCCTGTTCACAG -3'
(R):5'- TTCAAGAAACTGGTAGTGCAGG -3'

Sequencing Primer
(F):5'- AGTCCTCCCTGTTCCCAG -3'
(R):5'- TCTCTGGCAGGCCTCACAG -3'
Posted On2017-02-15